1. Cell Biology

Rab12 is a regulator of LRRK2 and its activation by damaged lysosomes

  1. Xiang Wang
  2. Vitaliy V Bondar
  3. Oliver B Davis
  4. Michael T Maloney
  5. Maayan Agam
  6. Marcus Y Chin
  7. Audrey Cheuk-Nga Ho
  8. Rajarshi Ghosh
  9. Dara E Leto
  10. David Joy
  11. Meredith EK Calvert
  12. Joseph W Lewcock
  13. Gilbert Di Paolo
  14. Robert G Thorne
  15. Zachary K Sweeney
  16. Anastasia G Henry  Is a corresponding author
  1. Denali Therapeutics, United States
  2. Department of Pharmaceutics, University of Minnesota, United States
https://doi.org/10.7554/eLife.87255
Share this article
Cite this article
  1. Xiang Wang
  2. Vitaliy V Bondar
  3. Oliver B Davis
  4. Michael T Maloney
  5. Maayan Agam
  6. Marcus Y Chin
  7. Audrey Cheuk-Nga Ho
  8. Rajarshi Ghosh
  9. Dara E Leto
  10. David Joy
  11. Meredith EK Calvert
  12. Joseph W Lewcock
  13. Gilbert Di Paolo
  14. Robert G Thorne
  15. Zachary K Sweeney
  16. Anastasia G Henry
(2023)
Rab12 is a regulator of LRRK2 and its activation by damaged lysosomes
eLife 12:e87255.
https://doi.org/10.7554/eLife.87255
  2. Download BibTeX
  3. Download .RIS

Abstract

Leucine-rich repeat kinase 2 (LRRK2) variants associated with Parkinson’s disease (PD) and Crohn’s disease lead to increased phosphorylation of its Rab substrates. While it has been recently shown that perturbations in cellular homeostasis including lysosomal damage can increase LRRK2 activity and localization to lysosomes, the molecular mechanisms by which LRRK2 activity is regulated have remained poorly defined. We performed a targeted siRNA screen to identify regulators of LRRK2 activity and identified Rab12 as a novel modulator of LRRK2-dependent phosphorylation of one of its substrates, Rab10. Using a combination of imaging and immunopurification methods to isolate lysosomes, we demonstrated that Rab12 is actively recruited to damaged lysosomes and leads to a local and LRRK2-dependent increase in Rab10 phosphorylation. PD-linked variants, including LRRK2 R1441G and VPS35 D620N, lead to increased recruitment of LRRK2 to the lysosome and a local elevation in lysosomal levels of pT73 Rab10. Together, these data suggest a conserved mechanism by which Rab12, in response to damage or expression of PD-associated variants, facilitates the recruitment of LRRK2 and phosphorylation of its Rab substrate(s) at the lysosome.

Editor's evaluation

This valuable study shows that Rab12 regulates LRRK2 activation via damaged lysosomes. The strength of evidence supporting the claim is compelling. Although key questions about the mechanism remain unanswered, these findings provide a useful template for further research.

https://doi.org/10.7554/eLife.87255.sa0

eLife digest

Lysosomes are cellular compartments tasked with breaking down large molecules such as lipids or proteins. They perform an essential role in helping cells dispose of obsolete or harmful components; in fact, defects in lysosome function are associated with a range of health conditions. For instance, many genes associated with an increased risk of developing Parkinson’s disease code for proteins required for lysosomes to work properly, such as the kinase LRRK2.

Previous work has shown that this enzyme gets recruited to the surface of damaged lysosomes, where it can modulate the function of another set of molecular actors by modifying them through a chemical process known as phosphorylation. Such activity is increased in harmful versions of LRRK2 linked to Parkinson’s disease. However, the molecular mechanisms which control LRRK2 activity or its recruitment to lysosomes remain unclear.

To examine this question, Wang, Bondar et al. first performed a targeted screen to identify proteins that can regulate LRRK2 activity. This revealed that Rab12, one of molecular actors that LRRK2 phosphorylates, can in turn modulate the activity of the enzyme. Further imaging and biochemical experiments then showed that Rab12 is recruited to damaged lysosomes and that this step was in fact necessary for LRRK2 to also relocate to these compartments. The data suggest that this Rab12-driven recruitment process increases the local concentration of LRRK2 near its Rab targets on the membrane of damaged lysosomes, and therefore leads to enhanced LRRK2 activity. Crucially, Wang, Bondar et al. showed that Rab12 also plays a role in the increased LRRK2 activity observed with two Parkinson’s disease-linked mutations (one in LRRK2 itself and one in another lysosomal regulator, VPS35), suggesting that increased LRRK2 concentration on lysosomes may be a conserved mechanism that leads to increased LRRK2 activity in disease.

Overall, these results highlight a new, Rab12-dependent mechanism that results in enhanced activity at the lysosomal membrane with variants associated with Parkinson’s disease, and for LRRK2 in general when lysosomes are damaged. This knowledge will be helpful to develop therapeutic strategies that target LRRK2, and to better understand how increased LRRK2 activity and lysosomal injury may be linked to Parkinson’s disease.

Introduction

Coding variants in LRRK2 can cause monogenic Parkinson’s disease (PD), and coding and non-coding variants in LRRK2 are associated with increased risk for developing sporadic PD and Crohn’s disease (Blauwendraat et al., 2020; Hui et al., 2018; Kluss et al., 2019). The majority of pathogenic LRRK2 variants cluster within its Roc-COR (Ras of complex proteins/C-terminal of Roc) GTPase tandem domain or kinase domain and contribute to disease risk by ultimately increasing LRRK2’s kinase activity (Alessi and Sammler, 2018; Kalogeropulou et al., 2022; Sheng et al., 2012). LRRK2 phosphorylates a subset of Rab GTPases, including Rab10 and Rab12. Excessive Rab phosphorylation can perturb interactions between Rabs and downstream effectors, which impairs various aspects of membrane trafficking including lysosomal function (Pfeffer, 2018; Steger et al., 2017; Steger et al., 2016). LRRK2 localizes primarily to the cytosol in an inactive state, and higher-order oligomerization and membrane recruitment appear to be required for LRRK2 activation and Rab phosphorylation (Berger et al., 2010; Biskup et al., 2006; Greggio et al., 2008; Schapansky et al., 2014). Recent work suggests that interactions between LRRK2 and its phosphorylated Rab substrates help maintain LRRK2 on membranes and result in a cooperative, feed-forward mechanism to promote additional Rab phosphorylation (Vides et al., 2022). However, it is not clear what mechanisms promote the initial recruitment of LRRK2 to membranes to trigger Rab phosphorylation or whether increased LRRK2 membrane association is a common driver of the elevated LRRK2 activity observed in PD.

Endolysosomal genes that modify PD risk and lysosomal damage can also increase LRRK2 activation and phosphorylation of its Rab substrates (Bonet-Ponce et al., 2020; Eguchi et al., 2018; Herbst et al., 2020; Liu et al., 2018; Mir et al., 2018; Purlyte et al., 2018). Rab29 and the retromer subunit VPS35, proteins that are genetically associated with PD and play key roles in lysosomal function by regulating sorting between the endolysosomal system and the trans-Golgi network, can modulate LRRK2 activity, as overexpression of Rab29 or expression of the pathogenic VPS35 D620N variant lead to significantly elevated LRRK2-mediated phosphorylation of Rab10 and other Rab substrates (Liu et al., 2018; Mir et al., 2018; Purlyte et al., 2018). LRRK2 kinase activity also appears to be increased in nonhereditary idiopathic PD patients (Di Maio et al., 2018; Fraser et al., 2016; Wang et al., 2021), and emerging data suggest that lysosomal damage more broadly may be a common trigger for LRRK2 activation. Lysosomotropic agents that disrupt the endolysosomal pH gradient or puncture lysosomal membranes enhance LRRK2 recruitment to damaged lysosomes and result in increased Rab10 phosphorylation (Bonet-Ponce et al., 2020; Eguchi et al., 2018; Herbst et al., 2020; Wang et al., 2021). Several hypotheses around the purpose of LRRK2 recruitment to damaged lysosomes have been proposed, including promotion of lysosomal membrane repair or clearance of lysosomal content through exocytosis or sorting of vesicles away from damaged lysosomes (Bonet-Ponce et al., 2020; Eguchi et al., 2018; Herbst et al., 2020). There is a clear need to better define how LRRK2 is recruited to lysosomes upon damage, how these steps translate to LRRK2 activation, and how broadly conserved these mechanisms are in PD.

Here, we identify Rab12 as a novel regulator of LRRK2 activity. Rab12 regulates LRRK2-dependent phosphorylation of Rab10 and mediates LRRK2 activation in response to lysosomal damage. We demonstrate that Rab12 promotes Rab phosphorylation by recruiting LRRK2 to lysosomes following lysosomal membrane rupture. Pathogenic PD variants including VPS35 D620N and LRRK2 R1441G also result in increased levels of LRRK2 and pT73 Rab10 on lysosomes. Together, our data delineate a conserved mechanism by which LRRK2 activity is regulated basally and in response to lysosomal damage and genetic variants associated with disease.

Results

siRNA-based screen identifies Rab12 as a key regulator of LRRK2 kinase activity

Although a subset of 14 Rab GTPases has been clearly established as LRRK2 substrates, increasing data suggest a reciprocal relationship exists in which Rab proteins may also contribute to LRRK2 membrane association and activation (Vides et al., 2022; Liu et al., 2018; Purlyte et al., 2018; Gomez et al., 2019). Previous studies have shown that overexpression of one such LRRK2 substrate, Rab29, can increase LRRK2-dependent phosphorylation of Rab10 by promoting its membrane association at the Golgi complex (Liu et al., 2018; Purlyte et al., 2018; Gomez et al., 2019). However, additional work in RAB29 KO models demonstrated that LRRK2 activity was minimally impacted by loss of Rab29, suggesting Rab29 does not regulate LRRK2 activity under physiological conditions (Kalogeropulou et al., 2020). To determine whether any LRRK2-Rab substrates were required for LRRK2 kinase activity, we performed a targeted siRNA screen on 14 Rab genes in human A549 cells that endogenously express both LRRK2 and Rab10. Rab10 phosphorylation was chosen as the endpoint to assess LRRK2 activation as it is an established readout of LRRK2 kinase activity that has been routinely used in preclinical and clinical settings (Wang et al., 2021; Fan et al., 2018; Jennings et al., 2022). The levels of Rab10 phosphorylation were measured using a previously described quantitative Meso Scale Discovery (MSD)-based assay (Wang et al., 2021). Greater than 50% knockdown of gene expression of each target was demonstrated using RT-qPCR-based analysis, and we confirmed that knockdown of the positive controls LRRK2 and RAB10 attenuated the phospho-Rab10 signal as expected (Figure 1A and B and Figure 1—figure supplement 1). RAB12 was the only hit gene whose knockdown significantly reduced Rab10 phosphorylation (Figure 1A). We confirmed that RAB12 knockdown reduced gene expression and led to a reduction in Rab12 protein levels (Figure 1C–E). RAB12 knockdown did not impact the levels of LRRK2 or Rab10, suggesting that Rab12 mediates Rab10 phosphorylation by regulating LRRK2’s activity rather than the stability of LRRK2 or Rab10 (Figure 1B, D, and F and Figure 1—figure supplement 1). We also confirmed previous observations that Rab29 does not regulate LRRK2 activity under endogenous expression conditions as RAB29 knockdown or genetic deletion did not impact Rab10 phosphorylation in A549 cells (Figure 1A and Figure 1—figure supplement 1). Together, these data identify Rab12 as a novel regulator of LRRK2 kinase activity.

Figure 1 with 1 supplement see all
Download asset Open asset
A targeted siRNA screen identifies Rab12 as a key regulator of LRRK2 kinase activity.

(A and B) A549 cells were transfected with siRNA targeting LRRK2 and its Rab substrates, lysed 3 days after transfection, and the levels of pT73 Rab10 and LRRK2 were quantified using Meso Scale Discovery (MSD)-based analysis. The MSD signal was normalized to the protein concentration, and data are shown on a log2 scale as the mean ± SEM; n=3 independent experiments, and statistical significance was determined using one-way analysis of variance (ANOVA) with Dunnett’s multiple comparison test. (C) RAB12 mRNA levels were quantified using RT-qPCR-based analysis and normalized to GAPDH following transfection with siRNAs targeting a scramble sequence or RAB12. Data are shown as the mean ± SEM; n=3 independent experiments, and statistical significance was determined using paired t-test. (D) The levels of pT73 Rab10, Rab10, Rab12, LRRK2, and Rab8a following siRNA-mediated knockdown of LRRK2 and its Rab substrates were assessed in A549 cells by western blot analysis. Shown is a representative immunoblot with GAPDH as a loading control. (E and F) The immunoblot signals from multiple experiments were quantified, and the Rab12 and Rab10 signal was normalized to GAPDH, normalized to the median within each batch and expressed as a fold change compared to the scramble control; data are shown as the mean ± SEM; n=3 independent experiments. Statistical significance was determined using unpaired t-test. *p<0.05, **p<0.01, ****p<0.0001.

Figure 1—source data 1

Raw data files for western blots.

https://cdn.elifesciences.org/articles/87255/elife-87255-fig1-data1-v2.zip
Figure 1—source data 2

Annotated western blots.

https://cdn.elifesciences.org/articles/87255/elife-87255-fig1-data2-v2.pdf

Rab12 deletion attenuates LRRK2-dependent phosphorylation of Rab10

To confirm that Rab12 regulates LRRK2-dependent Rab10 phosphorylation, we performed MSD and western blot analysis in RAB12 KO A549 cells. We demonstrated that loss of Rab12 significantly impairs Rab10 phosphorylation at T73, showing a comparable reduction to that observed with loss of LRRK2 (Figure 2A and B and Figure 2—figure supplement 1). Total Rab10 levels were not reduced with RAB12 deletion and, in fact, were elevated in two out of three RAB12 KO clones assessed, confirming that the impact of loss of Rab12 on Rab10 phosphorylation cannot be explained by an effect on the protein levels of Rab10 (Figure 2C). Rab12 is itself a substrate for LRRK2, and we next explored whether LRRK2-mediated phosphorylation of Rab12 contributed to LRRK2 activation. To assess this, we generated doxycycline-inducible stable cell lines in the RAB12 KO cell background to allow overexpression of wildtype (WT) or a phospho-deficient mutant Rab12 in which the LRRK2 phosphorylation site (S106) was converted to an alanine (Figure 2D). Overexpression of either WT Rab12 or Rab12 S106A restored Rab10 phosphorylation at T73 and did not impact LRRK2 levels (Figure 2E and F). This finding was further confirmed using Rab12 S106A KI cells generated using CRISPR-Cas9 (Figure 2—figure supplement 1).

Figure 2 with 1 supplement see all
Download asset Open asset
Rab12 regulates LRRK2 activation basally and in response to lysosomal damage and genetic variants associated with Parkinson’s disease (PD).

(A) The levels of Rab12, pS106 Rab12, pT73 Rab10, and Rab10 were assessed in wildtype (WT), RAB12 KO, and LRRK2 KO A549 cells by western blot analysis. Shown is a representative immunoblot with GAPDH as a loading control. (B) The levels of pT73 Rab10 were measured using a Meso Scale Discovery (MSD)-based assay. The MSD signal was normalized for protein input and expressed as a fold change compared to WT A549 cells; data are shown as the mean ± SEM; n=4 independent experiments, and statistical significance was determined using one-way analysis of variance (ANOVA) with Dunnett’s multiple comparison test. (C) Immunoblot signals from multiple experiments were quantified, and the Rab10 signal was normalized to GAPDH and expressed as a fold change compared to WT A549 cells. Data are shown as the mean ± SEM; n=4 independent experiments. Statistical significance was determined using one-way ANOVA with Dunnett’s multiple comparison test. (D–F) RAB12 KO A549 cells with doxycycline-inducible expression of WT RAB12 or a phospho-deficient variant of RAB12 (S106A) were treated with increasing concentrations of doxycycline for 3 days, and the levels of Rab12, pS106 Rab12, pT73 Rab10, and LRRK2 were measured. (D) A representative immunoblot is shown assessing Rab12 and pS106 Rab12 protein levels following doxycycline-induced expression of WT or RAB12 S106A, and GAPDH was used as a loading control. (E and F) The levels of pT73 Rab10 and LRRK2 were measured using MSD-based assays. MSD signals were normalized for protein concentration, and data were then normalized to the median within each batch and to the signals from the control group (RAB12 KO cells with inducible expression of WT Rab12 without doxycycline treatment). Data are shown as mean ± SEM; n=3–4 independent experiments, and statistical significance was determined using unpaired t-test on log transformed data. (G) The impact of Rab12 knockdown was measured in WT, LRRK2 R1441G KI, and VPS35 D620N KI A549 cells. Cells were transfected with siRNA targeting RAB12, and pT73 Rab10 levels were measured by MSD-based analysis 3 days after transfection. The MSD signal was normalized for protein input and then normalized to the median within each batch and is expressed as a fold change compared to WT A549 cells transfected with scramble siRNA. Data are shown as the mean ± SEM; n=5 independent experiments. Statistical significance was determined using one-way ANOVA with Tukey’s multiple comparison test on log transformed data. (H) WT, RAB12 KO, and LRRK2 KO A549 cells were treated with vehicle or L-leucyl-L-leucine methyl ester (LLOMe) (1 mM) for 2 hr, and the impact of LLOMe treatment on pT73 Rab10 levels was measured by MSD-based analysis. The MSD signal was normalized for protein input and is expressed as a fold change compared to WT A549 cells treated with vehicle. Data are shown as the mean ± SEM; n=4 independent experiments. Statistical significance was determined using two-way ANOVA with Sidak’s multiple comparison test. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.

Figure 2—source data 1

Raw data files for western blot.

https://cdn.elifesciences.org/articles/87255/elife-87255-fig2-data1-v2.zip
Figure 2—source data 2

Annotated western blots.

https://cdn.elifesciences.org/articles/87255/elife-87255-fig2-data2-v2.pdf

Rab12 promotes LRRK2 activation by PD-linked genetic variants or lysosomal damage

Previous studies have established that pathogenic PD-linked variants and lysosomal membrane disruption can lead to increased LRRK2 kinase activity (Bonet-Ponce et al., 2020; Eguchi et al., 2018; Mir et al., 2018; Wang et al., 2021). We next explored whether Rab12 might mediate LRRK2 activity in the context of either a pathogenic variant in LRRK2 (R1441G) or VPS35 (D620N). Rab10 phosphorylation was significantly reduced with RAB12 knockdown in LRRK2 R1441G KI and VPS35 D620N KI A549 cells (Figure 2G, Figure 2—figure supplement 1). Lysosomal membrane damage also increases LRRK2’s kinase activity, as treatment with L-leucyl-L-leucine methyl ester (LLOMe), a lysosomotropic agent that condenses into membranolytic polymers and ruptures the lysosomal membrane, has been shown to increase LRRK2-dependent phosphorylation of its Rab substrates (Bonet-Ponce et al., 2020; Eguchi et al., 2018). We confirmed that LLOMe treatment led to a significant increase in Rab10 phosphorylation in WT cells and demonstrated this effect was abolished in RAB12 KO cells (Figure 2H). Together, these data demonstrate that Rab12 is required to mediate LRRK2 activation in response to specific genetic variants associated with PD and lysosomal stress more broadly.

Rab12 regulates LRRK2-dependent phosphorylation of Rab10 on lysosomes

Lysosomal membrane permeabilization has been shown to increase the levels of LRRK2 and pT73 Rab10 associated with lysosomes using overexpression systems (Bonet-Ponce et al., 2020; Eguchi et al., 2018). Our data suggested that Rab12 may play a key role in facilitating the recruitment of LRRK2 and ultimate phosphorylation of Rab10 on lysosomes in response to lysosomal damage. To assess this, we employed an established lysosome immunoprecipitation (Lyso-IP) method that enables the rapid isolation of lysosomes (Abu-Remaileh et al., 2017). Lysosomes isolated from WT and RAB12 KO A549 cells treated with vehicle or LLOMe (1 mM) for 2 hr displayed increased levels of endogenous galectin-3 (Gal3), validating that LLOMe treatment induced lysosomal membrane rupture and exposed beta-galactosides normally present in the lumen of lysosomes (Figure 3A; Jia et al., 2020; Maejima et al., 2013; Paz et al., 2010). While LLOMe treatment reduced the levels of lysosomal-associated membrane protein 1 (LAMP1) in isolated lysosomes, the levels and localization of TMEM192-3x-HA, the lysosomal membrane protein used to isolate lysosomes, were not significantly impacted by LLOMe treatment (Figure 3A and Figure 3—figure supplement 1). We did not observe a loss of LAMP1 signal by immunofluorescence analysis, suggesting that LAMP1 may dissociate or be degraded from ruptured lysosomal membranes upon immunopurification. These data suggest that while LLOMe treatment results in lysosomal membrane damage, sufficient lysosomal integrity remains to enable purification of this subcellular compartment using TMEM192.

Figure 3 with 2 supplements see all
Download asset Open asset
Rab12 is recruited to lysosomes following lysosomal damage and promotes Rab10 phosphorylation at the lysosome.

(A) Lysosomes were isolated from wildtype (WT) and RAB12 KO A549 cells treated with vehicle or L-leucyl-L-leucine methyl ester (LLOMe) (1 mM) for 2 hr. The levels of pT73 Rab10, total Rab10, pS106 Rab12, galectin-3 (Gal3), lysosomal-associated membrane protein 1 (LAMP1), and HA were assessed by western blot analysis, and shown is a representative immunoblot. Fluorescence signals of immunoblots from multiple experiments were quantified. The pT73 Rab10 signal was normalized to the HA signal, then was normalized to the median within each experimental replicate and expressed as a fold change compared to lysosomes isolated from WT A549 cells treated with vehicle. n=6 independent experiments. Data are shown as the mean ± SEM, and statistical significance was determined using one-way analysis of variance (ANOVA) with Tukey’s multiple comparison test. (B) WT, RAB12 KO, and LRRK2 KO A549 cells were treated with vehicle or LLOMe (1 mM) for 2 hr, and the signals of pT73 Rab10 and LAMP1 were assessed by immunostaining. Scale bar, 20 μm. pT73 Rab10 (shown in magenta) and LAMP1 (shown in cyan) double positive puncta (i.e. overlap of magenta and cyan and shown in white) were quantified per cell from n=3 independent experiments. Data are shown as the mean ± SEM with and statistical significance was determined using two-way ANOVA with Sidak’s multiple comparison test. (C) Lysosomal Rab12 levels were assessed by western blot analysis from lysosomes isolated from WT and RAB12 KO A549 cells treated with vehicle or LLOMe (1 mM) for 2 hr. The Rab12 signals were normalized to the HA signals, then were normalized to the median within each experimental replicate and expressed as a fold change compared to lysosomes isolated from WT A549 cells treated with vehicle. n=6 independent experiments. Data are shown as the mean ± SEM, and statistical significance was determined using one-way ANOVA with Tukey’s multiple comparison test. (D) HEK293T cells expressing mCherry-Rab12 were treated with vehicle or LLOMe (1 mM) for 2 hr, fixed, and stained using an antibody against LAMP1. Colocalization of Rab12 and LAMP1 was assessed by measuring the Pearson’s correlation coefficient between mCherry-Rab12 (shown in magenta) and LAMP1 (shown in cyan); nocodazole (25 μΜ for 2 hr) treatment was included as a control to confirm colocalization. Scale bar, 10 μm. n=3 independent experiments. Data are shown as the mean ± SEM, and statistical significance was determined using repeated measures one-way ANOVA with Sidak’s multiple comparison test. (E) WT and LRRK2 KO A549 cells transiently expressing mCherry-Rab12 were treated with vehicle or LLOMe (1 mM) for 2 hr, and the LAMP1 levels were assessed by immunostaining. Scale bar, 20 μm. The intensity of mCherry-Rab12 signals (shown in magenta) in LAMP1 (shown in cyan)-positive region were quantified per cell from mCherry-Rab12 expressing cells (n=20 cells per condition, with cellular intensity between 2000 and 5000 fl. units) and averaged across wells (~4–6 wells per condition). n=3 independent experiments. The Rab12 signal was normalized to the median within each experimental replicate, and then expressed as a fold change compared to WT cells treated with vehicle. Data are shown as the mean ± SEM, and statistical significance was determined using one-way ANOVA with Sidak’s multiple comparison test. (F) HEK293T cells stably expressing eGFP-LRRK2 were transfected with mCherry-Rab12 and treated with LLOMe (1 mM) for 2 hr. Colocalization of mCherry-Rab12 (shown in magenta) and eGFP-LRRK2 (shown in cyan) was assessed by measuring the Pearson’s correlation coefficient in LLOMe-responding cells (n=10 cells per condition); nocodazole (25 μΜ) treatment was included to confirm colocalization. Scale bar, 10 μm. n=3 independent experiments. (G) HEK293T cells stably expressing eGFP-LRRK2 were treated with vehicle or LLOMe (1 mM) for 2 hr, fixed, and stained using an antibody against LAMP1. Colocalization of LRRK2 and LAMP1 was assessed by measuring the Pearson’s correlation coefficient between eGFP-LRRK2 (shown in cyan) and LAMP1 (shown in magenta); nocodazole (25 μΜ) treatment was included to confirm colocalization. Scale bar, 10 μm. n=3 independent experiments. Data are shown as the mean ± SEM, and statistical significance was determined using repeated measures one-way ANOVA with Sidak’s multiple comparison test. **p<0.01, ***p<0.001, and ****p<0.0001.

Figure 3—source data 1

Raw data files for western blot.

https://cdn.elifesciences.org/articles/87255/elife-87255-fig3-data1-v2.zip
Figure 3—source data 2

Annotated western blots.

https://cdn.elifesciences.org/articles/87255/elife-87255-fig3-data2-v2.pdf

Using this method, we showed that LLOMe treatment increased phosphorylation of Rab10 on isolated lysosomes from WT cells but failed to increase Rab10 phosphorylation on lysosomes from RAB12 KO cells, demonstrating that Rab12 is a critical regulator of Rab10 phosphorylation on lysosomes following lysosomal damage (Figure 3A and Figure 3—figure supplement 1). While Rab10 has been reported to primarily localize to the Golgi and endosomes, our data show that a proportion of Rab10 is localized to lysosomes basally and in response to lysosomal damage (Berndsen et al., 2019; Wang et al., 2010). To further explore the effect of Rab12 on the lysosomal levels of phospho-Rab10, we visualized phosphorylated Rab10 on lysosomes following LLOMe treatment in WT and RAB12 KO cells. LLOMe treatment significantly increased colocalization between pT73 Rab10 and LAMP1 in WT cells but had no effect in RAB12 KO cells, confirming that Rab12 is required for Rab10 phosphorylation on lysosomes in response to membrane rupture (Figure 3B and Figure 3—figure supplement 1).

Rab12 increases Rab10 phosphorylation by facilitating LRRK2 recruitment to lysosomes

We hypothesized that lysosomal membrane permeabilization may increase Rab12 recruitment to damaged lysosomes and that increased Rab12 levels on lysosomes may facilitate the lysosomal association of LRRK2 upon damage. Consistent with this idea, treatment with LLOMe significantly increased the levels of Rab12 on lysosomes assessed by western blot analysis from isolated lysosomes and by confocal imaging (Figure 3C–E and Figure 3—figure supplement 1). Further imaging analysis revealed that LLOMe treatment significantly increased the colocalization of Rab12 with the lysosomal marker LAMP1, but not with the Golgi marker GM130, as quantified by Pearson’s correlation coefficient (PCC), and this colocalization was preserved upon nocodazole-induced microtubule depolymerization (Figure 3D and Figure 3—figure supplements 1 and 2). Rab12 recruitment to damaged lysosomes was not impacted by LRRK2 deletion as Rab12 levels were similarly increased on lysosomes from WT and LRRK2 KO cells following lysosomal membrane permeabilization (Figure 3E and Figure 3—figure supplement 2). These data demonstrate that lysosomal membrane damage increases Rab12 localization to lysosomes and that this occurs in an LRRK2-independent manner, supporting the idea that Rab12 is an upstream regulator of LRRK2’s lysosomal localization and activity. Western blot analysis of isolated lysosomes showed that approximately 1% of total Rab12 was present on lysosomes at baseline and that this increased to approximately 1.5% following LLOMe treatment, while our imaging-based analysis revealed that approximately 12% of overexpressed Rab12 was present on lysosomes at baseline and increased to approximately 14% upon LLOMe treatment (Figure 3—figure supplement 2). These results suggest that a small percentage of Rab12 and LRRK2 are present on lysosomes at baseline and that lysosomal damage leads to a significant increase in the localization of both proteins to the lysosome (Figure 3—figure supplement 2), but precise quantification of the amount of Rab12 and LRRK2 on lysosomes under these conditions is difficult and warrants further study.

To gain additional insight around the dynamics of Rab12 and LRRK2 recruitment following lysosomal membrane permeabilization, we performed live-cell imaging of HEK293T cells overexpressing mCherry-tagged Rab12 and eGFP-tagged LRRK2 and assessed Rab12 and LRRK2 localization over time. Rab12 and LRRK2 showed a diffuse localization under baseline conditions, while LLOMe treatment increased the recruitment of Rab12 and LRRK2 to vesicular structures (Figure 3—figure supplement 2). Rab12 colocalization with LRRK2 increased over time following LLOMe treatment, supporting potential coordinated recruitment of these proteins to lysosomes upon damage (Figure 3F and Figure 3—figure supplement 2). LLOMe treatment also significantly increased the colocalization of LRRK2 with the lysosomal marker LAMP1 but not with the Golgi marker GM130 (Figure 3G and Figure 3—figure supplement 2). Together, these data demonstrate that Rab12 and LRRK2 both associate with lysosomes following membrane rupture.

To more directly assess whether Rab12 regulates the recruitment of LRRK2 to lysosomes upon lysosomal damage, we next examined the impact of RAB12 deletion on the lysosomal recruitment of LRRK2 upon lysosomal membrane permeabilization. Lysosomes were isolated from WT and RAB12 KO cells, and the endogenous levels of LRRK2 on lysosomes were quantified by western blot analysis. Lysosomal levels of LRRK2 were increased by approximately 2.5-fold following treatment with LLOMe in WT cells, and loss of Rab12 abrogated this LLOMe-induced increase (Figure 4A). These data show that Rab12 is required to facilitate LRRK2 localization to lysosomes following membrane damage.

Figure 4 with 1 supplement see all
Download asset Open asset
LRRK2 levels are increased on lysosomes following lysosomal damage in a Rab12-dependent manner and are also increased by Parkinson’s disease (PD)-linked variants.

(A) To analyze lysosomal LRRK2 levels, lysosomes were isolated from wildtype (WT) and RAB12 KO A549 cells treated with vehicle or L-leucyl-L-leucine methyl ester (LLOMe) (1 mM) for 4 hr. The levels of LRRK2, HA, lysosomal-associated membrane protein 1 (LAMP1), and galectin-3 (Gal3) were assessed by western blot analysis, and shown is a representative immunoblot. Fluorescence signals of immunoblots from multiple experiments were quantified, LRRK2 signal was normalized to the HA signal, then normalized to the median within each experiment, and expressed as a fold change compared to lysosomes isolated from WT A549 cells treated with vehicle. Data are shown as the mean ± SEM; n=4 independent experiments. Statistical significance was determined using one-way analysis of variance (ANOVA) with Tukey’s multiple comparison test with a single pooled variance. (B–C) To analyze lysosomal pRab10 levels, lysosomes were isolated from WT and LRRK2 R1441G KI (B) or VPS35 D620N KI (C) A549 cells treated with vehicle or LLOMe (1 mM) for 2 hr, and the levels of pT73 Rab10, Rab10, and LAMP1 were assessed by western blot analysis. Immunoblot signals from multiple experiments were quantified, and the pT73 Rab10 signal was expressed as a fold change compared to lysosomes isolated from WT A549 cells treated with vehicle. Data are shown as the mean ± SEM; n=3 independent experiments (B) and n=8 independent experiments (C). Statistical significance was determined using unpaired t-test. (D) Lysosomes were isolated from WT, LRRK2 R1441G KI, and VPS35 D620N KI A549 cells treated with vehicle or LLOMe (1 mM) for 4 hr. The levels of LRRK2, HA, LAMP1, and Gal3 were assessed by western blot analysis and shown is a representative immunoblot. Fluorescence signals of immunoblots from multiple experiments were quantified, the LRRK2 signal was normalized to the HA signal, then normalized to the median within each experiment, and expressed as a fold change compared to lysosomes isolated from WT A549 cells treated with vehicle. Data are shown as the mean ± SEM; n=7 independent experiments. Statistical significance was determined using one-way ANOVA with Dunnett’s multiple comparison test. *p<0.05, ***p<0.001, ****p<0.0001. (E) Model for proposed mechanism by which Rab12 promotes LRRK2 activation. Under steady-state conditions, LRRK2 localizes primarily to the cytoplasm. Lysosomal damage prompts the recruitment of Rab12, and Rab12 regulates the recruitment of LRRK2 to damaged lysosomes. An elevated local concentration of LRRK2 on lysosomes increases the likelihood for interactions with Rab GTPases localized on the lysosomal membrane, promoting LRRK2-dependent phosphorylation of its Rab substrates.

Figure 4—source data 1

Raw data files for western blot.

https://cdn.elifesciences.org/articles/87255/elife-87255-fig4-data1-v2.zip
Figure 4—source data 2

Annotated western blots.

https://cdn.elifesciences.org/articles/87255/elife-87255-fig4-data2-v2.pdf

Enhanced recruitment of LRRK2 to lysosomes may promote Rab phosphorylation by effectively increasing the local concentration of LRRK2 in proximity to its Rab substrates, and we hypothesized that such a mechanism might explain LRRK2 activation observed in additional contexts beyond lysosomal damage. We next examined whether two PD-linked genetic variants associated with increased LRRK2 kinase activity, LRRK2 R1441G and VPS35 D620N, also had increased levels of LRRK2 on lysosomes. Lysosomes were isolated from WT, LRRK2 R1441G KI, and VPS35 D620N KI A549 cells at baseline and following LLOMe treatment, and the levels of total and phospho-Rab10 and LRRK2 were subsequently assessed by western blot analysis. Expression of LRRK2 R1441G or VPS35 D620N led to an increase in Rab10 phosphorylation on isolated lysosomes at baseline, and the phosphorylation of Rab10 on lysosomes was further increased following LLOMe treatment (Figure 4B and C). The levels of LRRK2 on lysosomes were significantly increased in untreated LRRK2 R1441G KI cells and VPS35 D620N KI cells, suggesting that enhanced localization of LRRK2 to lysosomes and proximity to its Rab substrates may contribute to the elevated Rab10 phosphorylation observed on lysosomes at baseline in these cells (Figure 4D). Rab10 phosphorylation was increased on lysosomes in response to LLOMe treatment while the levels of LRRK2 were not significantly impacted on lysosomes isolated from LRRK2 R1441G and VPS35 D620N KI cells, suggesting additional mechanisms beyond LRRK2 localization may also contribute to LRRK2 activation in response to lysosomal damage in these cells. Together, these results suggest that Rab12 regulates LRRK2 localization to lysosomes upon damage and that this may be a conserved mechanism also employed to contribute to LRRK2 activation in response to PD-linked variants.

Discussion

Increased LRRK2 kinase activity is observed with pathogenic PD-linked variants and in sporadic PD patients, but many questions remain regarding the mechanisms by which LRRK2 activation is regulated basally and in response to endolysosomal stress associated with disease. We identify Rab12 as a novel regulator of LRRK2 activation and demonstrate that Rab12 plays a critical role in mediating LRRK2-dependent Rab phosphorylation in response to lysosomal damage. A recent CRISPR-based genome-wide screen for modifiers of Rab10 phosphorylation also identified RAB12 as a top hit, providing additional validation that Rab12 is a key regulator of LRRK2 activation (Dhekne et al., 2023). Our data show that lysosomal membrane rupture promotes Rab12 localization to lysosomes. We propose a model in which Rab12 recruits LRRK2 to the lysosome and enhances its activity on lysosomal membranes by increasing LRRK2’s local concentration near Rab10 and potentially other Rab substrates (Figure 4E). Previous studies suggested that another LRRK2 substrate, Rab29, can regulate LRRK2’s kinase activity and showed that exogenously expressed Rab29 is capable of activating LRRK2 at the trans-Golgi or at additional membranes when artificially anchored there (Purlyte et al., 2018; Gomez et al., 2019). However, these studies relied on overexpression of Rab29 to increase LRRK2 activity, and analyses of RAB29 KO cellular models or mice showed that RAB29 deletion minimally impacted LRRK2-dependent Rab10 phosphorylation (Kalogeropulou et al., 2020). Here, we used endogenous expression conditions to demonstrate that Rab12, but not Rab29, regulates LRRK2-mediated phosphorylation of Rab10 and that Rab12 regulates the localization and activation of LRRK2 on lysosomes upon lysosomal stress. The PD-linked pathogenic LRRK2 variant R1441G, which lies outside of LRRK2’s kinase domain, and the VPS35 D620N variant have been shown in previous studies and confirmed here to increase LRRK2 activity (Liu et al., 2018; Mir et al., 2018; Purlyte et al., 2018). Our results suggest that these variants may also promote LRRK2 activation by increasing Rab12-mediated LRRK2 localization to lysosomes, implying this may represent a general mechanism by which LRRK2 activity is increased by various genetic variants and environmental stressors associated with PD. We cannot rule out the possibility that additional mechanisms beyond increased proximity between LRRK2 and its Rab substrates may contribute to Rab10 phosphorylation following lysosomal damage, as the magnitude of change in Rab10 phosphorylation induced by LLOMe treatment was greater than the extent of LRRK2 recruitment to damaged lysosomes. Additional studies are warranted to determine how lysosomal membrane rupture triggers Rab12 recruitment, to identify other regulatory processes that may contribute to Rab phosphorylation upon lysosomal damage, and to better define how broadly such mechanisms are employed to drive LRRK2 activation in PD. As our work focused on the role of Rab12 in A549 cells, it will also be important to understand whether Rab12 similarly regulates LRRK2 activation and localization to damaged lysosomes in other cell types.

Our findings provide key insight into the mechanism by which LRRK2 activity is increased in response to lysosomal damage by demonstrating that Rab12 regulates LRRK2 localization to ruptured lysosomes. While the purpose of LRRK2 recruitment and activation on lysosomes is poorly defined, several hypotheses have been proposed suggesting that LRRK2 activity may be upregulated as a compensatory response to restore lysosomal homeostasis following damage. Previous work supports a model in which LRRK2 activity controls the decision to repair minor damage to lysosomal membranes through an ESCRT-mediated process or to target damaged lysosomes for degradation via lysophagy (Herbst et al., 2020). Additional studies suggested that LRRK2 hyperactivation triggers mechanisms aimed at clearing cargo from damaged lysosomes that have lost their proteolytic capacity, either through direct exocytosis of lysosomes or through a novel sorting process termed LYTL (lysosomal tubulation/sorting driven by LRRK2) in which tubules bud off from lysosomes following membrane rupture (Bonet-Ponce et al., 2020; Eguchi et al., 2018; Kluss et al., 2022). LRRK2 activation in the face of minor or acute lysosomal insults likely plays a beneficial role in maintaining lysosomal function, while chronic LRRK2 activation triggered by genetic variants with increased kinase activity or low-level lysosomal damage over time may ultimately impair the ability to effectively respond to membrane stress and maintain the balance between lysosomal repair and destruction. Macrophages from PD patients carrying pathogenic LRRK2 variants were shown to accumulate more damaged lysosomes compared to samples from healthy controls, suggesting that mechanisms that respond to and repair lysosomal membrane rupture may be perturbed in PD (Herbst et al., 2020). A deeper understanding of the mechanisms by which LRRK2 responds to lysosomal damage and how these contribute to PD pathogenesis is critical in guiding new potential therapeutic strategies targeting LRRK2 for the treatment of PD.

Materials and methods

Key resources table
Reagent type (species) or resourceDesignationSource or referenceIdentifiersAdditional information
AntibodypT73 Rab10 (rabbit monoclonal)Denali19-4WB: 1:500; MSD 1 ug/mL
AntibodypT73 Rab10 (rabbit monoclonal)Abcamab241060
RRID:AB_2884876		ICC: 1:100
AntibodyRab10 (mouse monoclonal)Abcamab104859
RRID:AB_10711207		WB: 1:500
AntibodyRab10 (rabbit monoclonal)CST8127
RRID:AB_10828219		ICC: 1:100
AntibodyRab10 (rabbit monoclonal)Abcamab181367MSD: 2 ug/mL
AntibodypS106 Rab12 (rabbit monoclonal)Abcamab256487
RRID:AB_2884880		WB: 1:500
AntibodyRab12 (rabbit polyclonal)Proteintech18843–1-AP
RRID:AB_10603469		WB: 1:500
AntibodyRab8a (rabbit monoclonal)Abcamab188574
RRID:AB_2814989		WB: 1:500
AntibodyHA (rabbit monoclonal)CST3724
RRID:AB_1549585		WB: 1:2000
ICC: 1:100
AntibodyGal3 (mouse monoclonal)BD556904
RRID:AB_396531		WB: 1:500
AntibodyLAMP1 (rabbit monoclonal)CST9091
RRID:AB_2687579		WB: 1:500
AntibodyLAMP1 (mouse monoclonal)Abcamab25630
RRID:AB_470708		WB: 1:1000
ICC: 1:100
AntibodyLRRK2 (mouse monoclonal)UC Davis/NIH NeuroMab FacilityN241A/34
RRID:AB_2877351		WB: 1:500
AntibodyLRRK2 (mouse monoclonal)Biolegend808201
RRID:AB_2564739		MSD: 1 μg/mL
AntibodyLRRK2Biolegend844401
RRID:AB_2565614		MSD: 0.5 μg/mL
AntibodypS935 LRRK2 (rabbit monoclonal)Abcamab133450
RRID:AB_2732035		WB: 1:500
MSD: 0.5 μg/mL
AntibodyGAPDH (mouse monoclonal)Abcamab8245
RRID:AB_2107448		WB: 1:500
AntibodyActin (mouse monoclonal)Sigma-AldrichA2228
RRID:AB_476697		WB: 1:5000
AntibodyGM130 (rabbit monoclonal)Abcamab52649
RRID: AB_880266		ICC: 1:200
Cell line (Homo sapiens)HEK293T cellsATCCCRL-3216
Cell line (H. sapiens)A549 cellsATCCCCL-185
Cell line (H. sapiens)Rab29 KO A549 cellsDr. Dario Alessi
Cell line (H. sapiens)Rab12 KO A549 cellsDenali
Cell line (H. sapiens)LRRK2 R1441G KI A549 cellsDenali
Cell line (H. sapiens)VPS35 D620N KI A549 cellsDenali
Cell line (H. sapiens)eGFP-LRRK2 HEK293T cellsDenali
Recombinant DNA reagentpLVX-TMEM192-3x-HADenali
Recombinant DNA reagentpcDNA3.1-eGFP-LRRK2Denali
Recombinant DNA reagentpcDNA3.1-mCherry-Rab12Denali
Chemical compoundLLOMeSigma-AldrichL73931 mM
Chemical compoundNocodazoleSigma-AldrichM140425 μΜ
Software, algorithmFijiPMID:29187165RRID:SCR_002285
Software, algorithmGraphPad PrismVersion 9.5.1RRID:SCR_002798
Software, algorithmImage Studio LiteVersion 5.2.5RRID:SCR_013715
Software, algorithmHarmonyVersions 4.9 and 5.1RRID:SCR_018809
Software, algorithmPython Programming Languagev3.10.8RRID:SCR_008394
Software, algorithmSciPyv1.9.3RRID:SCR_008058
Software, algorithmNapariv0.4.17RRID:SCR_022765
Software, algorithmscikit-imagev0.19.3RRID:SCR_021142
Software, algorithmNumPyv1.24.2RRID:SCR_008633

Generation of CRISPR KO and KI cell lines

Request a detailed protocol

Cell line engineering of A549 cells to generate homozygous LRRK2 R1441G (CGC/GGC) knock-in, homozygous LRRK2 KO, homozygous RAB12 KO, and homozygous VPS35 D620N (GAT/ATT) knock-in was performed using CRISPR/Cas9. Sequence information for generating targeting gRNA, ssODN donor, and PCR primers are as follows:

LRRK2 R1441G knock-in (A549)Sequences
sgRNAAAGAAGAAGCGCGAGCCUGG
Donor sequenceAAATGTGTGCCAACGAGAATCACAGGGGAAGAAGAAGCGCCAGCCTGGAGGGAAAGACACAAAACCCTCTTGTGTTTGCTTTCAAA
Forward PCR primer (5'–3')AGGCATGAAGATGGGAAAGGA
Reverse PCR primer (5'–3')GGAACCCTCGCTTATTCAGGA
LRRK2 knock-out (A549)Sequences
sgRNA 1GGGGACTGTCGACGGTGATCGGT
sgRNA 2GGTCCTAAACCTGGTCGCAAAGA
Donor sequencen/a
Forward PCR primer (5'–3')AGTCCGCTGAGTCAGTTTCTTC
Reverse PCR primer (5'–3')GGGCTCTTCATCCCGTTTACA
VPS35 D620N knock-in (A549)Sequences
sgRNAGAUGGCAGCUAGCUGUGCUU
Donor sequenceTGTTCACTAGGCATTTTCTCTGTATGAAGATGAAATCAGCAATTCAAAAGCACAGCTAGCTGCCATCACCTTGATCATTGGCACTTTTGA
Forward PCR primer (5'–3')GGCCATGACAACTGATCCCT
Reverse PCR primer (5'–3')GAGAGGGTGCAGCATGTTCT
Rab12 knock-out (A549)Sequences
sgRNAAUCAAACUGUAGAGCUAAG
Donor sequencen/a
Forward PCR primer (5'–3')GGGAGGTTATAGACACTGGTGC
Reverse PCR primer (5'–3')AACTGCTCCCCATGTGCAAG

CRISPR/Cas9-mediated knockout of LRRK2 or RAB12 and CRISPR/Cas9-mediated knock-in of LRRK2 R1441G or VPS35 D620N in A549 cells was performed by Synthego Corporation (Redwood City, CA, USA). To generate these cells, ribonucleoproteins containing the Cas9 protein and synthetic chemically modified sgRNA produced at Synthego were electroporated into the cells using Synthego’s optimized protocol. Editing efficiency was assessed upon recovery, 48 hr post electroporation. Specifically, genomic DNA was extracted from a portion of the cells, PCR amplified, and sequenced using Sanger sequencing. The resulting chromatograms are processed using Synthego Inference of CRISPR edits software (ice.synthego.com). To isolate monoclonal cell populations, edited cell pools were seeded at 1 cell/well using a single cell printer into 96- or 384-well plates. All wells were imaged every 3 days to ensure expansion from a single-cell clone. Clonal populations were screened and identified using the PCR-Sanger-ICE genotyping strategy described above.

Lyso-IP cell line generation

Request a detailed protocol

To enable the rapid isolation of lysosomes using immunopurification, WT human A549 cells and different CRISPR A549 cells (including LRRK2 KO, LRRK2 R1441G, RAB12 KO, and VPS35 D620N) were transduced with lentivirus carrying the transgene cassette for expression of TMEM192-3x-HA. A synthetic cDNA encoding TMEM192-3x-HA was cloned into pLVX-IRES-hygromycin lentiviral vector containing the CMV promoter. Stably expressing cells were selected using resistance to Hygromycin B (Thermo Fisher Scientific, Waltham, MA, USA, #10687010) supplied in growth medium at 200 μg/mL for 21 days. Following selection, cells were screened for the stable expression of TMEM192-3x-HA in lysosomes by quantifying the percentage of cells with colocalization of anti-HA and anti-LAMP1 by immunofluorescence, and by monitoring cell lysates for expression TMEM192-3x-HA (~30 kDa) by western blot.

Antibodies

For ICC, the following secondary antibodies (Thermo Fisher) were used at 1:1000 dilution: goat anti-mouse Alexa-Fluor 488 (A32723), goat anti-rabbit Alexa-Fluor 568 (A11036).

For western blot analysis, the following secondary antibodies (LI-COR Biosciences, Lincoln, NE, USA) were used at 1:20,000 dilution: IRDyes 800CW donkey anti-rabbit IgG (#926-32213), 680RD donkey anti-mouse IgG (#926-68072).

siRNA-mediated KD of LRRK2 and Rab GTPases

Request a detailed protocol

A549 cells were transfected with Dharmacon SMARTpool siRNA targeting 14 Rab GTPases, LRRK2 and non-targeting scramble control (Horizon Discovery, Cambridge, UK), using DharmaFECT 1 (Horizon, T-2001-01). Cells were collected 3 days after transfection for protein or mRNA analysis.

TargetsCatalog numberSequence
ON-TARGETplus Non-targeting ControlD-001810-10UGGUUUACAUGUCGACUAA
RAB3AL-009668-00GAAGAUGUCCGAGUCGUUG
RAB3BL-008825-00GGACACAGACCCGUCGAUG
RAB3CL-008520-00UGAGCGAGGUCAACAUUUA
RAB3DL-010822-00GUUCAAACUGCUACUGAUA
RAB5AL-004009-00GCAAGCAAGUCCUAACAUU
RAB5BL-004010-00GGAGCGAUAUCACAGCUUA
RAB5CL-004011-00UCAUUGCACUCGCGGGUAA
RAB8AL-003905-00CAGGAACGGUUUCGGACGA
RAB8BL-008744-00GCAAUUGACUAUGGGAUUA
RAB10L-010823-00GCAAGGGAGCAUGGUAUUA
RAB12L-023375-02CAUUUGAUGAUUUGCCGAA
RAB29L-010556-00GAGAACGGUUUCACAGGUU
RAB35L-009781-00GAUGAUGUGUGCCGAAUAU
RAB43L-028161-01GGAUGAGAGGGCACCGCAA
LRRK2L-006323-00GAAAUUAUCAUCCGACUAU

RT-qPCR-based analysis of Rab expression

Request a detailed protocol

The total RNA was extracted from cells using RNeasy Plus Micro Kit (QIAGEN, Hilden, Germany, #74034). cDNA was synthesized from 1 to 2 μg of RNA using Superscript IV VILO master mix (Thermo Fisher #11756050). The cDNA was diluted threefold and 1 μL of diluted cDNA was used as template. To measure the relative expression levels of mRNAs by RT-qPCR, Taqman Fast Advanced Master Mix (Thermo Fisher #4444557) was used, together with gene-specific primers using TaqMan Assays (Thermo Fisher). GAPDH was used as the housekeeping gene. The PCR was run using QuantStudio 6 Flex Real-Time PCR System, 384-well (Thermo Fisher). Gene expression was analyzed using 2^(delta-delta Ct) method with GAPDH as internal controls.

Taqman assay IDGene nameDye
Hs00923221_m1RAB3AFAM-MGB
Hs01001137_m1RAB3BFAM-MGB
Hs00384846_m1RAB3CFAM-MGB
Hs00758197_m1RAB3DFAM-MGB
Hs00702360_s1RAB5AFAM-MGB
Hs05027271_g1RAB5BFAM-MGB
Hs00904926_g1RAB5CFAM-MGB
Hs00180479_m1RAB8AFAM-MGB
Hs00213006_m1RAB8BFAM-MGB
Hs00794658_m1RAB10FAM-MGB
Hs01391604_m1RAB12FAM-MGB
Hs01026316_m1RAB29FAM-MGB
Hs00199284_m1RAB35FAM-MGB
Hs03006628_gHRAB43FAM-MGB
Hs01115057_m1LRRK2FAM-MGB
Hs99999905_m1GAPDHVIC

MSD-based analysis of pT73 Rab10, total and pSer935 LRRK2

Request a detailed protocol

LRRK2, pS935 LRRK2, and pT73-Rab10 MSD assays were previously established (Wang et al., 2021). Briefly, capture antibodies were biotinylated using EZ-Link NHS-LC-LC-Biotin (Thermo Fisher, #21343), and detection antibodies were conjugated using Sulfo-TAG NHS-Ester (Meso Scale Discovery [MSD], Rockville, MD, USA, R31AA-1). 96-well MSD GOLD Small Spot Streptavidin plates (MSD, L45SSA-1) were coated with 25 µL of capture antibody diluted in Diluent 100 (MSD, R50AA-2) for 1 hr at room temperature with 700 rpm shaking. After three washes with TBST, 25 µL samples were added each well and incubated at 4°C overnight with agitation at 700 rpm. After three additional washes with TBST, 25 µL of detection antibodies were added to each well diluted in TBST containing 25% MSD blocker A (MSD, R93AA-1) together with rabbit (Rockland Immunochemicals, Pottstown, PA, USA, D610-1000) and mouse gamma globin fraction (Rockland, D609-0100). After a 1 hr incubation at room temperature at 700 rpm and three washes with TBST, 150 µL MSD read buffer (MSD R92TC, 1:1 diluted with water) was added, and plates were read on the MSD Sector S 600.

AssayAntibody typeTargetsVendorCatalog numberConcentration (μg/mL)
pS935 LRRK2CapturepS935 LRRK2Abcamab1334500.5
DetectionTotal LRRK2BioLegend8082011
Total LRRK2CaptureTotal LRRK2BioLegend8444010.5
DetectionTotal LRRK2BioLegend8082011
pT73 Rab10CapturepT73 Rab10Denali19-41
DetectionTotal Rab10Abcamab1813672

Cell lysis and immunoblotting

Request a detailed protocol

Cells were lysed in lysis buffer (Cell Signaling Technology [CST], Danvers, MA, USA, #9803) supplemented with cOmplete tablet (Roche, Penzburg, Germany, #04693159001), phosSTOP (Roche #04906837001), and Benzonase nuclease (Sigma-Aldrich, St. Louis, MO, USA, E1014). Cell lysates were prepared by incubating with NuPage LDS Sample Buffer (Thermo Fisher, NP0007) and NuPAGE Sample Reducing Agent (Thermo Fisher, NP0004) for 5 min at 95°C to denature samples. Lysates were loaded onto NuPAGE 4–12% Bis-Tris gels (Thermo Fisher). Proteins were transferred to nitrocellulose membranes (Bio-Rad, Hercules, CA, USA) using Trans-Blot Turbo Transfer System (Bio-Rad). Membranes were blocked with Rockland blocking buffer at room temperature for 1 hr (Rockland Immunochemicals, Pottstown, PA, USA), incubated with primary antibody (diluted in Blocking Buffer) overnight at 4°C, and then with secondary antibodies (1:20,000 diluted in Blocking Buffer, LI-COR) for 1 hr at room temperature. Odyssey CLx Infrared Imaging System (LI-COR) was used for western blot detection and quantitation.

Cell culture and treatment

Request a detailed protocol

HEK293T cells and A549 cells were cultured in DMEM media (Thermo Fisher #11965-092) containing 1% Pen/Strep and 10% FBS (VWR International, Radnor, PA, USA, #97068-085). For LLOMe treatment, LLOMe (Sigma-Aldrich, #L7393) was added at 1 mM for 2 hr or 4 hr prior to fixation or lysing cells for downstream analysis. Nocodazole (Sigma-Aldrich, #M1404) was added at 25 μΜ for 2 hr prior to fixation or live-cell imaging. Cells were routinely screened to confirm the absence of mycoplasma contamination.

Generation of Dox-inducible cell lines expressing Rab12

Request a detailed protocol

Doxycycline-inducible cell lines were generated to stably express WT Rab12 or a phospho-deficient mutant of Rab12 (S106A) in RAB12 KO A549 cells. Briefly, lentiviral constructs were generated by cloning 3XFLAG-RAB12 (or RAB12 S106A) into the pLVX-TetOne-Puro vector. Lentivirus was produced by transfecting the plasmids in HEK293T cells using Lenti-X Packaging Single Shots (Takara Bio, Kusatsu, Shiga, Japan, #631278). The media containing lentivirus were collected from transfected cells and were further concentrated by 50-fold using Lenti-X Concentrator (Takara, #631231). RAB12 KO A549 cells were infected with lentivirus expressing WT 3XFLAG-RAB12 or 3XFLAG-RAB12 S106A mutant. Cells carrying the lentiviral vectors were selected with puromycin (1 μg/mL). To enable the expression of WT Rab12 or the Rab12 S106A mutant, doxycycline (0.1, 0.5, and 1 μg/mL) was added in the cell culture for 3 days.

Immunoprecipitation of lysosomes using TMEM192-HAx3

Request a detailed protocol

Lysosomes were isolated by immunoprecipitation from cells expressing the TMEM192-HAx3 transgene as described previously (Abu-Remaileh et al., 2017) with the following modifications. Cells were plated in 15 cm culture dishes such that they reached full confluency on the day of the experiment. All subsequent steps were performed at 4°C or on ice with pre-chilled reagents, unless otherwise noted. Media was removed and monolayers were rinsed with KPBS buffer (136 mM KCl, 10 mM KH2PO4, pH 7.25), harvested by scraping into fresh KPBS and pelleted via centrifugation. Cell pellets were resuspended in KPBS + buffer (KPBS supplemented with 3.6% [wt/vol] iodixanol [OptiPrep; Sigma-Aldrich], cOmplete protease inhibitor [Roche], and PhosStop phosphatase inhibitor [Roche]), and cells were fractionated by passing the suspension through a 21 G needle five times followed by centrifugation at 800 × g for 10 min. Post-nuclear supernatant (PNS) was harvested and incubated with anti-HA magnetic beads (pre-blocked with BSA and washed with KPBS buffer; Thermo Fisher) for 15 min with end-over-end rotation. Lysosome-bound beads were washed three times with KPBS + buffer, and samples used for immunoblotting were eluted from beads by heating to 95°C for 10 min in 1× NuPAGE LDS Sample Buffer (Thermo Fisher).

Analysis of total and pRab10 and total and pRab12 levels on isolated lysosomes from WT, RAB12 KO, and PD-linked variant KI A549 cell models

Request a detailed protocol

For analysis of pRab10 levels on isolated lysosomes, one confluent 15 cm plate of cells was used per experimental condition. Cells were treated with 1 mM LLOMe (or vehicle) for 2 hr at 37°C prior to isolation of lysosomes via anti-HA immunoprecipitation as described above. Lyso-IP were performed with 60 µL of anti-HA magnetic bead slurry per condition. Immunoblotting for pRab10 and pRab12 levels was performed in parallel with analysis of total Rab10 and Rab12 levels, as detailed above, using 20% of total immunoprecipitated material per condition. pT73 Rab10, pS106 Rab12, total Rab10, total Rab12, and HA band intensities were quantified from immunoblots using ImageStudio Lite software (LI-COR), and the phospho- and total Rab band intensities were normalized to HA band intensity within each experimental condition. Data were normalized to the median value within each replicate and was then normalized to the mean value of vehicle-treated WT samples across replicates. Calculations for the total fraction of Rab12 present on immunoprecipitated lysosomes were performed by extrapolating the quantitated western blot signal of both the IP and PNS fractions out to 100%, and then calculating the percent of total estimated Rab12 signal captured in the IP divided by the total estimated Rab12 signal present in the PNS sample.

Analysis of LRRK2 levels on isolated lysosomes from A549 cell models

Request a detailed protocol

For analysis of LRRK2 levels on isolated lysosomes, three confluent 15 cm plates of cells (seeded 24 hr prior to the assay start) were used per experimental condition. Cells were treated with 1 mM LLOMe (or vehicle) for 4 hr at 37°C and then lysosomes were isolated via anti-HA immunoprecipitation as described above. Lyso-IP were performed with 150 µL of anti-HA magnetic bead slurry per condition. For immunoblot detection of endogenous LRRK2, 25% of the total immunoprecipitated material (per condition) was loaded onto a 3–8% Tris-Acetate gel (Thermo Fisher), fully resolved gels were transferred to nitrocellulose membranes, probed overnight at 4°C with a 1/500 dilution of mouse anti-LRRK2 (clone N241A/34; UC Davis/NIH NeuroMab Facility, Davis, CA, USA), and imaged using standard immunoblotting protocol detailed above. LRRK2 and HA band intensity was quantified from immunoblots using ImageStudio Lite software (LI-COR), LRRK2 intensity was normalized to HA band intensity within each experimental condition, data was normalized to the median value within each replicate, and then was normalized to the mean value of vehicle-treated WT samples across replicates. Calculations for the total fraction of LRRK2 present on immunoprecipitated lysosomes were performed as for Rab12 (see above).

Immunostaining of pT73 Rab10, Rab10, HA, and LAMP1 and image analysis

Request a detailed protocol

WT, RAB12 KO, and LRRK2 KO A549 cells were seeded in 96-well plates (Revvity, Waltham, MA, USA, Phenoplate, #6055302), and then treated with vehicle or LLOMe (1 mM). After 2 hr, cells were fixed with 4% PFA for 15 min, permeabilized and blocked with blocking buffer (5% Normal Donkey Serum/0.05% Triton X-100/PBS) for 1 hr at room temperature. Primary antibodies were diluted in blocking buffer and incubated overnight at 4°C. pT73 Rab10 antibody (Abcam, ab241060, 1:100), Rab10 antibody (CST, 8127, 1:100), LAMP1 antibody (Abcam, ab25630, 1:100), and HA antibody (CST, 3724, 1:100) were used in the study. After three washes with PBS/0.05% Triton X-100, secondary fluorescently labeled antibodies were diluted in blocking buffer and incubated for 1 hr at room temperature. DAPI (1:1000) and cell mask deep red (1:5000, Thermo Fisher, C10046) were diluted in PBS/0.05% Triton X-100 and incubated for 10 min. After three washes with PBS/0.05% Triton X-100, the cell plates were imaged on an automated confocal high-content imaging system (Revvity, Opera Phenix Plus High-Content Screening System) using a 63× water immersion objective lens with excitation lasers (405 nm, 488 nm, 561 nm, 640 nm) and preset emission filters. Channels were separated to avoid fluorescence crosstalk. A custom analysis was developed in the Harmony 4.9 image analysis software (Revvity) to enable image analysis. For analysis of puncta intensity, pT73 Rab10 or total Rab10 spots were defined using ‘Finding Spots’ building blocks, and the sum of corrected spot intensity per cell was used to measure puncta signals. The colocalization between pT73 Rab10 or TMEM192-HA puncta and LAMP1-positive lysosomes were measured with object-based analysis. Briefly, pT73 Rab10 or TMEM192-HA and LAMP1 spots were independently defined using separate ‘Find Spots’ building blocks. Colocalized pT73 Rab10 and LAMP1 spots or TMEM192-HA and LAMP1 spots were identified using the geometric center overlap method within the ‘Select Population’ tool. The average number of colocalized spots were calculated per cell from 16 fields per well (for pT73 Rab10 and LAMP1 analysis) or 20 fields per well (for HA and LAMP1 analysis) and averaged across the well.

Image analysis of the localization of Rab12 and LRRK2 to lysosomes and Golgi

Request a detailed protocol

For the colocalization analysis of Rab12 and organelle markers, HEK293T cells were transfected with mCherry-Rab12 plasmid (pcDNA3.1 vector) using Lipofectamine LTX with Plus Reagent (Thermo Fisher #15338100), and cells were plated onto poly-lysine-coated 96-well plates (Revvity, Waltham, MA, USA, Phenoplate, #6055302). Two days after transfection, cells were treated with vehicle or LLOMe (1 mM), with or without nocodazole (25 μΜ). After 2 hr, cells were fixed and immunostained with a LAMP1 antibody (Abcam, ab25630, 1:100) or GM130 antibody (Abcam ab52649). Cell plates were imaged on an automated confocal high-content imaging system (Revvity, Opera Phenix Plus High-Content Screening System) using a 40× water immersion objective lens. For the colocalization analysis of LRRK2 and organelle markers, HEK293T cells stably expressing eGFP-LRRK2 were used. For the colocalization analysis of LRRK2 and Rab12, HEK293T cells stably expressing eGFP-LRRK2 were transfected with mCherry-Rab12 plasmid. After LLOMe and nocodazole treatment, cell plates were imaged using a 63× water immersion objective lens.

For image analysis, we used PCC to assess the colocalization between various pairs of fluorophores: (1) mCherry-Rab12 and 488 LAMP1-positive lysosomes, (2) mCherry-Rab12 and 647 GM130-positive Golgi, (3) eGFP-LRRK2 and 568 LAMP1-positive lysosomes, (4) eGFP-LRRK2 and 647 GM130-positive Golgi, and (5) mCherry-Rab12 and eGFP-LRRK2, as the PCC is a commonly used intensity-based measurement to quantify colocalization between two fluorophores. A custom analysis algorithm built in the Harmony image analysis software (versions 5.1 and 4.9, Revvity) was used to calculate PCC. For Rab12 or LRRK2 singly expressing cells, individual nuclei were identified with DAPI and cell boundaries were defined using either the mCherry or GFP fluorescent channel, respectively. Rab12-positive and LRRK2-positive cells were selected after thresholding for extremely low or high intensities. Lysosomes and Golgi were independently segmented using the ‘Find Spots’ building block in Harmony, and PCC for either Rab12 or LRRK2 was calculated on a per-cell basis within these two compartments. The average PCC score was calculated from ~30 fields per well across three independent biological replicates.

For Rab12-LRRK2 colocalization, the number of Rab12-LRRK2 co-expressing cells was much lower than their single-expressing counterparts. Therefore, additional steps were taken to manually identify cells that expressed both mCherry-Rab12 and eGFP-LRRK2 at correct levels. mCherry-Rab12 and eGFP-LRRK2 PCC were calculated on a per-cell basis from ~3 wells across three independent biological replicates.

Calculation of the percentage of Rab12 and LRRK2 in lysosomes was performed using the Harmony image analysis software (versions 5.1 and 4.9, Revvity) to determine the percentage of mCherry-Rab12 intensity in lysosomes compared to the whole cell. From Rab12-positive cells, lysosomes were segmented using the LAMP1 channel. mCherry-Rab12 sum intensity from lysosomes was calculated and divided by the total sum mCherry-Rab12 intensity within the entire cell. Values were calculated on a per-cell basis, averaged across ~30 fields per well, and across three independent biological replicates. A similar image analysis process was adapted for calculating the percentage of LRRK2 within lysosomes.

Image analysis of Rab12 in WT and LRRK2 KO cells

Request a detailed protocol

WT and LRRK2 KO A549 cells were transfected with mCherry Rab12 plasmid (pcDNA3.1 vector) using Lipofectamine LTX with Plus Reagent (Thermo Fisher #15338100), and cells were plated onto poly-lysine-coated 96-well plates (Revvity, Waltham, MA, USA, Phenoplate, #6055302). Two days after transfection, cells were treated with vehicle or LLOMe (1 mM). After 2 hr, cells were fixed and immunostained with LAMP1 antibody (Abcam, ab25630, 1:100). Cell plates were imaged on an automated confocal high-content imaging system (Revvity, Opera Phenix Plus High-Content Screening System) using a 63× water immersion objective lens.

For the image analysis, cells were identified through a nuclear stain (DAPI) and lysosomes were segmented with LAMP1 staining using the ‘Find Image Region’ building block in the Harmony 5.1 analysis software (Revvity). The total mCherry-Rab12 levels present in lysosomes were determined by calculating the mean fluorescence intensity of the 568 nm channel within the LAMP1 area. Values were measured from mCherry-Rab12 expressing cells (n=20 cells per condition, with cellular intensity between 2000 and 5000 fl. units) and averaged across wells (~4–6 wells per condition).

Live-cell imaging of Rab12 and LRRK2 in HEK293T cells

Request a detailed protocol

HEK293T cells were transfected with eGFP-LRRK2 and mCherry-Rab12 plasmids (pcDNA3.1 vectors) using Lipofectamine LTX with Plus Reagent (Thermo Fisher #15338100), and cells were plated onto poly-lysine-coated 96-well plates (Corning Inc, Corning, NY, USA, BioCoat plates, #354640). Two days after transfection, cells were incubated with Hoechst 33342 (1 μg/mL, Thermo Fisher #62249) and CellMask Deep Red Plasma membrane Stain (1:2000, Thermo Fisher C10046) for 10 min. After replacing the cell culture media containing 1 mM LLOMe, the cell plates were immediately started for live-cell imaging on an automated spinning-disk confocal high-content imaging system (Revvity, Opera Phenix) using a 40× water immersion objective lens under 5% CO2 and 37°C condition. The confocal images were taken every 10 min for 90 min in total.

Time lapse cell segmentation analysis

Request a detailed protocol

Fields of view containing cells co-transfected for eGFP-LRRK2 and mCherry-Rab12 were manually selected from the time lapse dataset across three independent experiments. For each field, channel, and timepoint, the z-stack was converted to a 2D image by maximum intensity projection, then the background intensity was estimated by smoothing the image with a Gaussian filter with a kernel standard deviation of 50 pixels (~14.8 μm) using the ndimage module in scipy v1.9.3 (Virtanen et al., 2020). The background was subtracted from the original image and all pixels below the background intensity were set to zero. Background subtracted images were loaded into napari v0.4.17 (Sofroniew et al., 2022) as 2D+time images for segmentation.

To better visualize cells co-expressing low levels of LRRK2 and Rab12, the contrast limits were set to between 0 and 125 AU for LRRK2 and between 0 and 600 AU for Rab12. Cells were included in the segmentation if they (1) appeared morphologically healthy, (2) were visible throughout the time series, and (3) co-expressed LRRK2 and Rab12 at levels above background, but below the maximum contrast limit. Cells were segmented using the brush tool in napari using a brush size of 10 pixels (~3.0 μm). Cells were painted to the edge of the cell border including the nucleus but excluding signal from cell debris and other extracellular sources. Tracking cells across frames was typically possible through a combination of proximity and morphology, but where the assignment was ambiguous, those cells were excluded from further analysis (n=2). The resulting dataset contained 55 segmented cells.

For each cell, the non-background subtracted LRRK2 and Rab12 signals were extracted and normalized to between 0.0 and 1.0 by subtracting 200 AU and then dividing by 800 AU. Values above 1.0 or below 0.0 were set to 1.0 or 0.0, respectively. For all pixels under the cell mask, the PCC I was calculated between the normalized LRRK2 and Rab12 signals using the pearsonr function in the scipy.stats module. Cell properties such as area, perimeter, and mean intensity in each channel were extracted for each timepoint using the regionprops function in scikit-image v0.19.3 (van der Walt et al., 2014). Cells were filtered for quality by fitting a least squares line to the mean intensity of both LRRK2 and Rab12 signal for each and excluding any cells where the slopes were negative (n=31 cells excluded), resulting in 24 validated cell traces. Normalized intensity and correlation coefficients were plotted as mean of all 24 traces ± standard error (SEM) using Prism Version 9.5.1 (GraphPad).

Statistical analysis

Request a detailed protocol

Data are shown as mean ± SEM, and all statistical analysis was performed in GraphPad Prism 9. Unpaired (or paired) t-tests were used for statistical analyses of experiments with two treatment groups. For more than two groups, analysis was performed using one-way analysis of variance (ANOVA) with Tukey’s multiple comparison, one-way ANOVA with Sidak’s multiple comparison test, one-way ANOVA with Dunnett’s multiple comparison test, repeated measures one-way ANOVA with Dunnett’s multiple comparison or two-way ANOVA with Sidak’s test, as indicated in figure legends. Comparisons were considered significant where *, p<0.05; **, p<0.01; ***, p<0.001; ****, p<0.0001.

Materials availability

Request a detailed protocol

The pT73 Rab10 antibody used in these studies is available from the corresponding author upon reasonable request.

Data availability

All data generated or analyzed during this study are included in the manuscript and supporting files; source data files for western blots have been provided for all figures.

References

    1. Pfeffer SR
    (2018) LRRK2 and Rab GTPases
    Biochemical Society Transactions 46:1707–1712.
    https://doi.org/10.1042/BST20180470

Decision letter

  1. Shaeri Mukherjee
    Reviewing Editor; University of California, San Francisco, United States
  2. Vivek Malhotra
    Senior Editor; Barcelona Institute for Science and Technology, Spain

Our editorial process produces two outputs: i) public reviews designed to be posted alongside the preprint for the benefit of readers; ii) feedback on the manuscript for the authors, including requests for revisions, shown below. We also include an acceptance summary that explains what the editors found interesting or important about the work.

Decision letter after peer review:

Thank you for submitting your article "Rab12 regulates LRRK2 activity by promoting its localization to lysosomes" for consideration by eLife. Your article has been reviewed by 3 peer reviewers, and the evaluation has been overseen by a Reviewing Editor and Vivek Malhotra as the Senior Editor. The reviewers have opted to remain anonymous.

The reviewers have discussed their reviews with one another, and the Reviewing Editor has drafted this to help you prepare a revised submission.

Essential revisions:

1. Tone down conclusions throughout as indicated in the reviews.

2. Verify the LRRK2 dependence of activation of rab10 phosphorylation.

3. Demonstrate that Rab12 does in fact have a more important role than Rab29.

4. Clarify the discrepancy in Figure 4 (see comments).

5. The data do not show lysosomal accumulation of rab12 precedes LRRK2 (point #1 above) and clarify Fig. 3 as described by Reviewer #3.

Reviewer #1 (Recommendations for the authors):

1. Fig. 2G. The A549 R1441G cells show lower kinase activity than wild-type cells. Does this clone have less LRRK2? These cells should also be listed under Key Reagents.

2. Figure 3E would benefit from nocodazole addition to most clearly demonstrate the true co-localization of Rab12 and LRRK2 on lysosomes (rather than concentration in a very crowded perinuclear area).

3. Line 326. "Rab12 and LRRK2 showed a primarily cytosolic localization [at baseline]." Most Rabs are 50% on membranes or bound to GDI in cytosol. The images shown highlight massive concentration in one part of the cell upon LLOME addition and the faint, small-vesicle bound Rab12 would appear very diffuse without actually being non-membrane associated or "cytosolic". Perhaps the word "diffuse" would be more precise for the Rab?

4. In the Lyso-IPs, there seems to be a lot of Rab10 on lysosomes yet by microscopy that is never seen. Perhaps the tag is pulling down some Golgi membranes for biosynthetic trafficking of the HA-tag? It might be worth mentioning that this represents a very small fraction of total Rab10 if that is the case. Also, the LAMP is lost in LLOME samples and this should also be mentioned.

5. Normally mechanism is required for an eLife paper but this is a short report in a competitive area where other complementary stories will bolster this work (Biorxiv doi: https://doi.org/10.1101/2023.02.17.529028).

Reviewer #3 (Recommendations for the authors):

Although the overall role of Rab12 in activating LRRK2 is well supported by the data, there are several areas where the study could be improved.

1. Although it is likely that the reported relationship between Rab12 and LRRK2 is generalizable to other cell types, this remains to be shown outside of A549 cells. Unapanta et al, bioRxiv, 2022 showed that Rab38 can also play an important role in activating LRRK2 in melanocytes and other cell types might employ other LRRK2 activation mechanisms. Although it is beyond the scope of this study, it will eventually be important to see how Rab12 KO in a mouse model affects LRRK2 activity across a range of tissues (similar to what the Alessi lab did for Rab29).

2. It is puzzling that even though LLoMe-induced lysosome damage does not increase LRRK2-R1441G abundance at lysosomes (Fig 4D), it still promotes LRRK2-dependent phosphorylation of Rab10 by LRRK2-R1441G (Fig 4B). This result suggests that something more than recruitment to lysosomes is required for Rab12-dependent LRRK2 activation. At a minimum, some discussion of these results and the potential impacts of LRRK2 activation mechanisms would be helpful. The claim in lines 395-397 that these pathogenic variants are unable to further respond to additional lysosomal stress is undermined by the discrepancy between 4B vs 4D.

3. Based on data in Figure 4A, it is claimed that lysosome damage causes LRRK2 to accumulate at lysosomes. However, in Figure 4D the same treatment fails to yield a similar increase in LRRK2 levels at lysosomes. These inconsistencies undermine confidence in these results and should be explained.

4. In multiple figures, treatment with LLoMe results in a decrease in the amount of LAMP1 that is recovered in the TMEM192-HA "lysosome" immunoisolations. This effect was not explained. However, it raises a concern about whether LLoMe is truly triggering LRRK2 recruitment to lysosomes versus the possibility that there is also an effect on TMEM192-HA localization. Is LRRK2 getting recruited to lysosomes? Or is TMEM192-HA moving to a different compartment in the endolysosomal pathway? Some simple experiments that test the colocalization between TMEM192-HA and lysosome proteins +/- LLoMe treatment would help to address this.

5. Fig. 3A shows phosphorylated Rab12 at lysosomes but does not show total Rab12 at lysosomes. Showing total Rab12 is required to support claims of regulated recruitment.

6. The methods section lacks details for cell line generation and validation. How was Cas9 delivered? How were clones selected? How were mutations in Rab12 assessed?

7. Details are lacking on the source and identity of the TMEM192-3xHA plasmid.

[Editors’ note: further revisions were suggested prior to acceptance, as described below.]

Thank you for resubmitting your work entitled "Rab12 regulates LRRK2 activity by facilitating its localization to lysosomes" for further consideration by eLife. Your revised article has been evaluated by Vivek Malhotra (Senior Editor) and a Reviewing Editor.

The manuscript has been improved but there are some remaining issues that need to be addressed, as outlined below:

The main concerns that remained were:

1) Title is not appropriate. See below comments from Reviewer #1.

2) Some of the data interpretations were not appropriate. All reviewers commented on it.

3) Please discuss alternate models, see point 3 from Reviewer #2.

Reviewer #1 (Recommendations for the authors):

I was really hoping to move this forward; unfortunately, the response to the reviewer comments is not sufficient as follows.

1. The authors were asked to modify the title. As it stands, the title implies that Rab12 is on lysosomes which it is normally not, and that LRRK2 is only active on lysosomes which is also not true. The title is really important and either needs to indicate that Rab12 promotes localization to DAMAGED lysosomes or be otherwise modified.

2. LRRK2 still produces pRab10 in Rab12 knockout cells. The authors claim on Page 13 that Rab12 is necessary and sufficient for Rab10 phosphorylation but this is not correct. It is clear that LRRK2 still produces pRab10 in cells lacking Rab12 from blots in 2A and 1D. In Figure 2C, the authors show significant variability in Rab10 levels. This highlights the importance of normalizing phosphoRab10 levels to total Rab10 levels. Please normalize data to total Rab10 and not GAPDH or other protein. This is standard in this field.

3. The only data on Rab12 being on lysosomes comes from lyso-IPs. In order to understand the magnitude of the process being studied here the authors need to state the fraction of the total Rab12 and total LRRK2 in the LysoIPs of Fig. 3 and 4. This is essential. For example, it is possible that Rab12 increases LRRK2 on lysosomes from 2% of total to 4% of total. The reader needs this information.

4. The authors were asked to carry out nocodazole experiments to document true lysosome co-localization. 293T cells are poorly adherent and give poor microscopy images with or without LLOME or nocodazole. Why didn't the authors use their A549 cells as in Fig. 3E? Note that a Golgi marker in these cells would have shown complete co-localization with lysosomes in this scenario-this is why nocodazole is so important to separate membrane compartments. The authors need a clear and well controlled experiment showing that the structures they visualize are lysosomes and not Golgi derived vesicles. This circles back to the title of the paper.

Reviewer #2 (Recommendations for the authors):

The authors have responded to all of the concerns raised. It is nice to see that LRRK2 is not required for the localization of rab12 to the lysosome. What is very clear is that LLOMe recruits rab12 to the lysosome, induces phosphorylation of rab10 and rab12 is required for phosphorylation of rab10. However, a discrepancy remains between the recruitment of LRRK2 to the lysosome by LLOMe, which is not as apparent for wt LRRK2 in Fig. 4D as in 4A, and the phosphorylation of rab10 induced by LLOMe (4B,C). So it seems likely, as the authors have now included in the results, that mechanisms other than lysosomal recruitment of LRRK2 contribute to the phosphorylation of rab10. Importantly, they have also shown that LRRK2 is responsible for the induction by LLOMe (Fig. 2), so I think this is fine, but they should probably include this important consideration in the discussion as well as the results.

Reviewer #3 (Recommendations for the authors):

The revised manuscript provides strong evidence that Rab12 can regulate the ability of LRRK2 to phosphorylate Rab10 and that this occurs at least in part by regulating the abundance of LRRK2 at lysosomes. Although key questions about the mechanism remain unanswered, these are still important findings. New data was added to the manuscript that helped to address concerns that were raised during the previous review. Below I have provided some suggestions for clarification to the text that should be addressable without the need for new experiments. However, I also remain concerned about some important results and their interpretation (points 1-).

1. There is a discrepancy between the strong decrease in LAMP1 levels in the lysosome IP samples in Figure 3A and that is not seen in the LAMP1 immunofluorescence signal in 3C. This should be acknowledged and/or explained in the text.

2. Lines 272-275 imply that previous studies (references 32 and 33) also saw reductions in LAMP1 levels on purified lysosomes following LLoMe treatment. However, I could not find evidence of this in the papers that were cited.

3. There is still a discrepancy between Figure 4A-C where LLoMe activates LRRK2 (as measured by phosphor-Rab10) even in the context of VPS35-D620N and LRRK2-R1441G and Figure 4D where LLoMe does not change LRRK2 lysosome abundance in the same cells. The authors touched on this in the response to reviewers but the answer was not definitive. The description and interpretation of these results in the manuscript text is confusing as it is unclear to what extent LRRK2 kinase activity is regulated in response to these stimuli versus LRRK2 localization and proximity to substrates. The data suggests that there might be independent changes to LRRK2 localization and activity. It is not necessary for the authors to solve these puzzles but they should be more clearly presented.

4. Line 168: The statement that Rab12 is necessary and sufficient is too strong. Some commentary is required to at minimum acknowledge that this study only examined A549 cells and that the extent that the findings are generalizable to other cell types remains unknown.

5. Figure 3A and D and Figure 4A-D should also show the total cell lysates rather than just the IP results.

6. Figure 4E and Line 505 over-reach in stating that Rab12 mediates LRRK2 recruitment to lysosomes. Proving this would require evidence that a direct interaction between LRRK2 and Rab12 is necessary for LRRK2 recruitment and activation.

https://doi.org/10.7554/eLife.87255.sa1

Author response

Essential revisions:

Reviewer #1 (Recommendations for the authors):

1. Fig. 2G. The A549 R1441G cells show lower kinase activity than wild-type cells. Does this clone have less LRRK2? These cells should also be listed under Key Reagents.

The LRRK2 R1441G KI A549 cells show reduced Rab10 phosphorylation when assessed at the whole cell level. This variant is also associated with reduced LRRK2 levels as assessed by MSD-based analysis in cell lysates as shown in Author response image 1, which likely contributes to the lower level of Rab10 phosphorylation observed with the LRRK2 R1441G variant in whole cell lysates.

Author response image 1
Download asset Open asset

However, analysis of both LRRK2 levels and Rab10 phosphorylation on lysosomes isolated from LRRK2 R1441G KI cells shows an increase in both the lysosomal levels of LRRK2 and pT73 Rab10 with this PD-linked variant. These data demonstrate that the LRRK2 R1441G variant leads to a relative increase in LRRK2 activity at the lysosome.We have updated the Key Reagents list to also include all knock-in and knockout A549 cell models that were employed in this study. We thank the reviewer for pointing this omission out in our initial submission.

2. Figure 3E would benefit from nocodazole addition to most clearly demonstrate the true co-localization of Rab12 and LRRK2 on lysosomes (rather than concentration in a very crowded perinuclear area).

As suggested by the reviewer, we employed nocodazole treatment to assess whether Rab12 and LRRK2 colocalization is maintained when the clustering of late endosomes/lysosomes in the perinuclear region is disrupted by blocking microtubule assembly. Briefly, HEK293 cells overexpressing mCherry-Rab12 and eGFP-LRRK2 were pre-treated with nocodazole (50 uM) for 2.5 hours and then treated with either vehicle or LLOMe (1mM) for 1.5 hours in the continued presence of nocodazole. The distribution of mCherry-Rab12 and eGFP-LRRK2 was then assessed using high-content confocal imaging. Unfortunately, treatment with both LLOMe and nocodazole caused significant cytotoxicity, rendering us unable to quantify the extent of colocalization of Rab12 and LRRK2 with and without nocodazole treatment following lysosomal membrane permeabilization. We were able to observe a few examples of surviving cells in our studies. In these cells, we found that the apparent colocalization of Rab12 and LRRK2 (overlay in white) following LLOMe treatment was maintained with nocodazole treatment (see example images in Author response image 2; scale bar: 20μm). These data suggest that the significant colocalization between Rab12 and LRRK2 observed in our manuscript is not simply due to increased concentration of vesicular structures near the perinuclear region. Because of the severe toxicity observed in our experiments, we prefer not to include this data in the revised manuscript.

Author response image 2
Download asset Open asset

3. Line 326. "Rab12 and LRRK2 showed a primarily cytosolic localization [at baseline]." Most Rabs are 50% on membranes or bound to GDI in cytosol. The images shown highlight massive concentration in one part of the cell upon LLOME addition and the faint, small-vesicle bound Rab12 would appear very diffuse without actually being non-membrane associated or "cytosolic". Perhaps the word "diffuse" would be more precise for the Rab?

As suggested by the reviewer, we have replaced “cytosolic” with “diffuse” to more precisely describe the localization of Rab12 observed in our imaging experiments.

4. In the Lyso-IPs, there seems to be a lot of Rab10 on lysosomes yet by microscopy that is never seen. Perhaps the tag is pulling down some Golgi membranes for biosynthetic trafficking of the HA-tag? It might be worth mentioning that this represents a very small fraction of total Rab10 if that is the case. Also, the LAMP is lost in LLOME samples and this should also be mentioned.

The reviewer raises valid points regarding the use of Lyso-IP method to isolate lysosomes following membrane damage. While we do observe significant enrichment of lysosomal proteins using the Lyso-IP method, we cannot rule out the possibility that some of the Rab10 detected arises from Golgi components that are also immunoprecipitated from biosynthetic trafficking of TMEM192-3xHA. To address this concern, we employed imaging-based methods to assess the colocalization of phospho-Rab10 with lysosomal markers at baseline and following LLOMe treatment in WT and RAB12 KO cells (Figure 3C). Using this orthogonal approach, we also observed significant colocalization of pT73 Rab10 with the lysosomal marker LAMP1 following LLOMe treatment that is abolished by RAB12 deletion or LRRK2 deletion. These results provide additional confirmation that LRRK2 promotes Rab10 phosphorylation on lysosomes in a Rab12-dependent manner. As suggested by the reviewer, we have added new text (lines 326-328 of the updated manuscript) to address this point: “While Rab10 has been reported to primarily localize to the Golgi and endosomes, our data show that a proportion of Rab10 is localized to lysosomes basally and in response to lysosomal damage(34, 35).

The reviewer also astutely noted the loss of LAMP1 detected in our isolated lysosomes following LLOMe treatment. This is an effect we have observed across our Lyso-IP experiments. Our data is consistent with previous studies that have also observed a loss of lysosomal transmembrane proteins following LLOMe treatment (Lee et al Dev Cell 2020 PMID: 32916093 and Eriksson et al Cell Death Dis 2020 PMID: 32409651). Our hypothesis is that the loss of LAMP1 following lysosomal membrane permeabilization may arise from the redistribution of LAMPs to the cytosol in small vesicles and/or targeted degradation via lysophagy, as suggested by the studies highlighted. Whereas LAMP1 levels are robustly reduced following LLOMe treatment, we observed a minimal impact on the levels of exogenously-expressed TMEM192-3xHA in isolated lysosomes (see Figure 3A and D and Figure 4A). As suggested by the reviewer, we have added new text to our updated manuscript that discusses the reduction in LAMP1 observed following LLOMe treatment and potential explanations for this effect (lines 299-304).

To increase confidence in the use of TMEM192-3xHA to isolate damaged lysosomes, we have also added new data to the updated manuscript assessing the localization of TMEM192-3xHA to lysosomes at baseline and following lysosomal membrane damage via LLOMe. We confirmed that LLOMe treatment did not impact the lysosomal localization of TMEM192-3xHA, and this new data has been added to Figure 3- figure 1 supplement and the modified text is on page 15 of the revised manuscript.

These data suggest that while LLOMe treatment results in lysosomal membrane damage, sufficient lysosomal integrity remains to enable purification of this subcellular compartment using TMEM192.

5. Normally mechanism is required for an eLife paper but this is a short report in a competitive area where other complementary stories will bolster this work (Biorxiv doi: https://doi.org/10.1101/2023.02.17.529028).

We agree with the reviewer that the observations from this study open up many interesting questions regarding the mechanism by which Rab12 senses lysosomal damage and promotes enhanced LRRK2-dependent phosphorylation of Rab10 on lysosomes. We have submitted this as a short report to communicate our findings in a timely fashion given the competitive nature of this field, and we hope to provide additional mechanistic insight regarding this process in future work.

Reviewer #3 (Recommendations for the authors):

Although the overall role of Rab12 in activating LRRK2 is well supported by the data, there are several areas where the study could be improved.

1. Although it is likely that the reported relationship between Rab12 and LRRK2 is generalizable to other cell types, this remains to be shown outside of A549 cells. Unapanta et al, bioRxiv, 2022 showed that Rab38 can also play an important role in activating LRRK2 in melanocytes and other cell types might employ other LRRK2 activation mechanisms. Although it is beyond the scope of this study, it will eventually be important to see how Rab12 KO in a mouse model affects LRRK2 activity across a range of tissues (similar to what the Alessi lab did for Rab29).

The reviewer raises a great question regarding whether Rab12 regulates LRRK2 activity in additional cell types beyond the A549 cell model used in the present work. In a recent preprint that also identified Rab12 as a key regulator of LRRK2 activation, the authors characterize the impact of loss of Rab12 in vivo by analyzing LRRK2-dependent Rab10 phosphorylation across different tissues in Rab12 KO mice (Dhekne et al bioRxiv 2023 doi: https://doi.org/10.1101/2023.02.17.529028). The authors observed reductions in phospho-Rab10 levels in Rab12 KO mouse lung with trends toward reduction in the large intestine and kidney. This study supports the relevance of Rab12 as a regulator of LRRK2 activity beyond the A549 cell model used in the present work. The authors could not assess the role for Rab12 in regulating LRRK2 activity in the brain given challenges in detecting pT73 Rab10 in brain tissue, and additional studies in human iPSC-derived CNS cells are warranted to better assess the consequences of Rab12 deletion in the brain. These additional studies will undoubtedly be a focus of future work by us (and others) but are beyond scope for the present manuscript.

2. It is puzzling that even though LLoMe-induced lysosome damage does not increase LRRK2-R1441G abundance at lysosomes (Fig 4D), it still promotes LRRK2-dependent phosphorylation of Rab10 by LRRK2-R1441G (Fig 4B). This result suggests that something more than recruitment to lysosomes is required for Rab12-dependent LRRK2 activation. At a minimum, some discussion of these results and the potential impacts of LRRK2 activation mechanisms would be helpful. The claim in lines 395-397 that these pathogenic variants are unable to further respond to additional lysosomal stress is undermined by the discrepancy between 4B vs 4D.

The reviewer raises an important point regarding the potential mechanisms by which the LRRK2 R1441G variant leads to increased Rab10 phosphorylation at the lysosome and whether additional factors beyond LRRK2 localization may contribute to this effect. We focused on detecting effects on the localization of endogenously-expressed LRRK2 to avoid any potential artifacts caused by LRRK2 overexpression. Because of this, the amount of LRRK2 detected on isolated lysosomes is low, and technical variability in lysosomal isolations across independent experiments can complicate our ability to quantify smaller effects on LRRK2 levels on lysosomes. To add confidence in the effect of lysosomal damage on LRRK2 levels in LRRK2 R1441G and VPS35 D620N cells, we performed two additional, independent replicates. The updated compiled data confirm that both variants have elevated levels of LRRK2 on isolated lysosomes at baseline compared to WT cells and show a non-significant trend of a further increase in LRRK2 levels following LLOMe treatment (updated Figure 4D).

These data suggest that increased LRRK2 recruitment to lysosomes upon damage may at least, in part, contribute to elevated Rab10 phosphorylation observed in LRRK2 R1441G and VPS35 D620N KI cells with LLOMe treatment. The extent of lysosomal Rab10 phosphorylation is far greater than the extent of increase in LRRK2 levels following LLOMe treatment, suggesting that additional mechanisms beyond increased recruitment of LRRK2 to lysosomes may contribute to this effect on LRRK2 activation as suggested by the reviewer.

In addition to updating Figure 4 with this new data, we have also modified the text to remove our conclusion that LLOMe treatment does not further impact LRRK2 levels in PD-linked variant cells and added new text to the results section (as described above) to highlight that additional mechanisms beyond increased LRRK2 recruitment to lysosomes may also contribute to LRRK2 activation following lysosomal damage in these cells.

3. Based on data in Figure 4A, it is claimed that lysosome damage causes LRRK2 to accumulate at lysosomes. However, in Figure 4D the same treatment fails to yield a similar increase in LRRK2 levels at lysosomes. These inconsistencies undermine confidence in these results and should be explained.

The reviewer astutely points out that Figure 4A shows a significant increase in LRRK2 levels on lysosomes in WT cells following LLOMe treatment, while Figure 4D shows a non-significant trend toward an increase in lysosomal LRRK2 levels under similar conditions. As described above, we think this variability is due to the low levels of LRRK2 detected on lysosomes upon endogenous expression and technical variability in recovery of lysosomes across experiments using the Lyso-IP method.

Our observations are consistent with previous work (Eguchi et al PNAS 2018 PMID: 30209220, Herbst et al EMBO J 2020 PMID: 32643832, and Bonet-Ponce et al Science Adv 2020 PMID: 33177079), and further supported by orthogonal imaging-based studies (Figure 3F-I), increasing confidence that lysosomal damage causes LRRK2 to accumulate at lysosomes.

4. In multiple figures, treatment with LLoMe results in a decrease in the amount of LAMP1 that is recovered in the TMEM192-HA "lysosome" immunoisolations. This effect was not explained. However, it raises a concern about whether LLoMe is truly triggering LRRK2 recruitment to lysosomes versus the possibility that there is also an effect on TMEM192-HA localization. Is LRRK2 getting recruited to lysosomes? Or is TMEM192-HA moving to a different compartment in the endolysosomal pathway? Some simple experiments that test the colocalization between TMEM192-HA and lysosome proteins +/- LLoMe treatment would help to address this.

The reviewer raises a valid concern regarding whether LLOMe treatment might confound our ability to successfully isolate lysosomes following lysosomal membrane permeabilization. As described in more detail in our response to point #4 from Reviewer #1, we consistently observe a depletion in LAMP1 levels on isolated lysosomes following LLOMe treatment while the lysosomal levels of TMEM192-3xHA were minimally impacted. Our hypothesis is that the loss of LAMP1 following lysosomal membrane permeabilization may arise from the redistribution of LAMPs to the cytosol in small vesicles and/or targeted degradation via lysophagy in response to lysosomal damage, as suggested by Lee et al Dev Cell 2020 PMID: 32916093 and Eriksson et al Cell Death Dis 2020 PMID: 32409651. Based on the reviewer’s feedback, we have added new text to our updated manuscript that discusses the reduction in LAMP1 observed following LLOMe treatment and potential explanations for this effect (lines 299-304).

We thank the reviewer for their suggestion to examine the lysosomal localization of TMEM192-3xHA with and without LLOMe treatment to increase confidence in the use of Lyso-IP to isolated damaged lysosomes. We assessed the colocalization of TMEM192-HA and the lysosomal marker LAMP1 treated with vehicle or LLOMe using high-content confocal imaging. We quantified the extent of colocalization between HA-tagged TMEM192 and LAMP1 and confirmed that LLOMe treatment has no impact on the localization of TMEM192 to lysosomes. This new data add confidence in the use of the Lyso-IP method to isolate damaged lysosomes and has been added to Figure 3- figure supplement 1.

5. Fig. 3A shows phosphorylated Rab12 at lysosomes but does not show total Rab12 at lysosomes. Showing total Rab12 is required to support claims of regulated recruitment.

We agree with the reviewer that it is important to show total Rab12 levels on isolated lysosomes at baseline and following LLOMe treatment to support our claims of regulated recruitment. This data can be found in Figure 3D of our updated manuscript, showing that Rab12 levels are significantly increased on lysosomes following LLOMe treatment and that this signal is lost in RAB12 KO cells to confirm the specificity of our antibody.

6. The methods section lacks details for cell line generation and validation. How was Cas9 delivered? How were clones selected? How were mutations in Rab12 assessed?

We thank the reviewer for suggesting that we expand on our methods section with f urther details on how our cell lines were generated and validated. Ribonucleoproteins containing the Cas9 protein and synthetic chemically modified sgRNA produced at Synthego were electroporated into the cells using Synthego's optimized protocol. Editing efficiency was assessed upon recovery, 48 hours post electroporation. Specifically, genomic DNA was extracted from a portion of the cells, PCR amplified and sequenced using Sanger sequencing. The resulting chromatograms are processed using Synthego Inference of CRISPR edits software (ice.synthego.com). To isolate monoclonal cell populations, edited cell pools were seeded at 1 cell/well using a single cell printer into 96 or 384 well plates. All wells were imaged every 3 days to ensure expansion from a single-cell clone. Clonal populations were screened and validated using the PCR-Sanger-ICE genotyping strategy to confirm successful gene deletion or editing.

We have updated our Materials and Methods section to describe how these cell lines were generated and validated.

7. Details are lacking on the source and identity of the TMEM192-3xHA plasmid.

We have added additional details on the generation of the TMEM192-3xHA plasmid and the construct itself to the Materials and Methods section.

[Editors’ note: further revisions were suggested prior to acceptance, as described below.]

Reviewer #1 (Recommendations for the authors):

I was really hoping to move this forward; unfortunately, the response to the reviewer comments is not sufficient as follows.

1. The authors were asked to modify the title. As it stands, the title implies that Rab12 is on lysosomes which it is normally not, and that LRRK2 is only active on lysosomes which is also not true. The title is really important and either needs to indicate that Rab12 promotes localization to DAMAGED lysosomes or be otherwise modified.

We agree with the reviewer that the title for our manuscript is very important and something we want to make sure best describes the findings from our study. Based on the reviewer’s comment, we had modified our title in our last resubmission to “Rab12 regulates LRRK2 activity by facilitating its localization to lysosomes” to soften our language around the requirement of Rab12 in mediating LRRK2’s localization to the lysosomes. We now appreciate that this did not fully address the reviewer’s concern around the role that lysosomal damage plays in this recruitment. Based on the reviewer’s feedback, we have further modified our title to “Rab12 is a regulator of LRRK2 activity and mediates its localization to damaged lysosomes.” We thank the reviewer for their additional feedback on the title and are happy to further adjust the title as needed.

2. LRRK2 still produces pRab10 in Rab12 knockout cells. The authors claim on Page 13 that Rab12 is necessary and sufficient for Rab10 phosphorylation but this is not correct. It is clear that LRRK2 still produces pRab10 in cells lacking Rab12 from blots in 2A and 1D. In Figure 2C, the authors show significant variability in Rab10 levels. This highlights the importance of normalizing phosphoRab10 levels to total Rab10 levels. Please normalize data to total Rab10 and not GAPDH or other protein. This is standard in this field.

We appreciate the reviewer’s comments around the requirement of Rab12 for LRRK2-dependent phosphorylation of Rab10, and we have provided new data and further revised the text to address these points. Using our sensitive MSD-based assay to quantify pT73 Rab10 levels under basal conditions, we observed a similar reduction in Rab10 phosphorylation with Rab12 knockdown or deletion as we also observed with LRRK2 knockdown or deletion (Figure 1A, Figure 2A and B) which led us to make this comment. As the reviewer noted, we do observe some residual Rab10 phosphorylation upon Rab12 knockdown/deletion when assessed by western blot analysis (Figure 2A and Figure 1D). This signal is also observed in LRRK2 KO A549 cells, which may be a result of background signal from western blot analysis or may also suggest that a minor proportion of Rab10 phosphorylation may be LRRK2- and Rab12- independent in this cell model as proposed by the reviewer. We appreciate this reviewer’s point and have therefore modified the text to remove any reference to Rab12 being required or sufficient for LRRK2-dependent Rab10 phosphorylation. Specifically, we have changed the subsection heading of the results section on page 13 from “Rab12 is necessary and sufficient for LRRK2-dependent phosphorylation of Rab10" to “Rab12 deletion attenuates LRRK2-dependent phosphorylation of Rab10.”

The reviewer also commented on variability in total Rab10 levels across clones examined in Figure 2C and suggested we normalize pRab10 levels to total Rab10 levels. Phospho-Rab10 levels in Figure 2B were measured using a quantitative MSD-based assay and normalized for protein input. Issues with specificity and sensitivity precluded us from using an MSD-based assay against total Rab10, so western blot analysis was used to measure total Rab10 levels. To address the reviewer’s concern, we have now normalized pRab10 levels (quantified using an MSD-based assay) to total Rab10 levels measured using western blot analysis. These new data have been added as a new supplementary figure (Figure 2- figure supplement 1B and G). These new data confirm our original findings in Figure 2B, strongly suggesting that alterations in Rab10 levels do not explain the significant reduction in pRab10 levels observed in Rab12 KO cells. They are presented on page 13 of the revised manuscript.

3. The only data on Rab12 being on lysosomes comes from lyso-IPs. In order to understand the magnitude of the process being studied here the authors need to state the fraction of the total Rab12 and total LRRK2 in the LysoIPs of Fig. 3 and 4. This is essential. For example, it is possible that Rab12 increases LRRK2 on lysosomes from 2% of total to 4% of total. The reader needs this information.

We thank the reviewer for these comments and have now added several additional data panels related to them that we feel have strengthened the paper. To address the reviewer’s question regarding the percentage of total LRRK2 and Rab12 present on isolated lysosomes, we quantified LRRK2, Rab12, and HA band intensity in WT cells from both the IP and PNS (post-nuclear supernatant, the input fraction used for the IP) samples used for Figure 3D and 4A. We then calculated the total amount of each species present in both sample types by extrapolation based on the amount of sample loaded for western blot analysis and determined the total percentage of each species recovered in the IP. This analysis indicates that ~2% of LRRK2 is on lysosomes at baseline, and LLOMe treatment roughly doubles this to ~4% present on lysosomes. Similarly, ~1% of total Rab12 is present on lysosomes at baseline, and LLOMe treatment increased this to ~1.5% present on lysosomes. This analysis has been added as new data to our updated manuscript in Figure 3- figure supplement 2G and is presented on page 22 of the revised manuscript. Our analysis of total HA recovery in the IP samples confirms that less than 100% of the total HA-labeled lysosomes present in the input were captured in all cases – by experimental design to ensure equal capture across conditions– which ultimately suggests that the calculated total LRRK2 and Rab12 levels present on lysosomes are likely underestimates of the true values.

We had previously included imaging data that showed Rab12 localization to lysosomes basally that was significantly increased upon LLOMe treatment (Figure 3E). As an orthogonal approach to address the reviewer’s question, we quantified the percentage of LRRK2 and Rab12 on lysosomes at baseline and following LLOMe treatment using imaging-based analysis. Specifically, we overexpressed either fluorescently-tagged LRRK2 or Rab12 and quantified the % of LRRK2 or Rab12 on lysosomes by measuring the amount of LRRK2 or Rab12 signal that colocalized with LAMP1 normalized to the total LRRK2 or Rab12 signal per cell. Our imaging-based analysis suggested that ~5% of LRRK2 localized to lysosomes at baseline and that LLOMe significantly increased this to ~6%, and ~12% of Rab12 was observed at lysosomes basally and ~14% following LLOMe treatment. These data have been added as a new figure panel in Figure 3- figure supplement 2H and is presented on page 22 of the revised manuscript. This analysis required overexpression of both LRRK2 and Rab12 which also has its caveats with respect to recapitulating endogenous localization but nonetheless provides a useful complimentary approach.

We employed two distinct methods to estimate the percentage of LRRK2 and Rab12 on lysosomes basally and following LLOMe treatment. Both methods support our conclusions that a portion of total LRRK2 and Rab12 localize to lysosomes and that lysosomal damage further increases their lysosomal localization. The potential caveats associated with both approaches make it difficult in the end for us to be confident about the precise quantification of both proteins on lysosomes. Nevertheless, we do agree with the reviewer that this data addresses an essential question and have therefore decided to include it with the caveat as stated on lines 733-738:

“These results also show that a small percentage of Rab12 and LRRK2 are present on lysosomes at baseline and that lysosomal damage leads to a significant increase in the localization of both proteins to the lysosome (Figure 3- figure supplement 2), but precise quantification of the amount of Rab12 and LRRK2 on lysosomes under these conditions is difficult and warrants further study.”

4. The authors were asked to carry out nocodazole experiments to document true lysosome co-localization. 293T cells are poorly adherent and give poor microscopy images with or without LLOME or nocodazole. Why didn't the authors use their A549 cells as in Fig. 3E? Note that a Golgi marker in these cells would have shown complete co-localization with lysosomes in this scenario-this is why nocodazole is so important to separate membrane compartments. The authors need a clear and well controlled experiment showing that the structures they visualize are lysosomes and not Golgi derived vesicles. This circles back to the title of the paper.

We thank the reviewer for their suggestion to use nocodazole to confirm the colocalization of LRRK2 and Rab12 and to more clearly understand if LRRK2 and Rab12 are recruited to lysosomes rather than the Golgi upon LLOMe treatment. In line with their suggestions, we have conducted new studies and added new figures to the manuscript that we feel have further strengthened the manuscript.

To examine this, we conducted new studies using overexpression of eGFP-tagged LRRK2 and mCherry-tagged Rab12 to follow the localization of each protein at baseline and following lysosomal damage. We had initially tried to use A549 cells, but it turned out to be very challenging to identify a sufficient number of cells expressing both eGFP-LRRK2 and mCherry-Rab12 due to poor transfection efficiency in A549 cells (especially for eGFP-LRRK2 due to its large size). We therefore used HEK293T cells to address the reviewer’s comment. We further optimized the concentration and duration of nocodazole treatment based on previously-published work (Fasimoye et al PNAS 2023 and Berndsen et al eLife, 2019) and found that reducing the nocodazole treatment to 25 uM for 2 hours reduced toxicity and enabled subsequent analysis. We saw that the Golgi marker GM130 showed fragmented and dispersed punctate structures, confirming the effects of nocodazole treatment in this paradigm.

By performing this new imaging analysis, our data showed that:

1) LLOMe treatment significantly increased the colocalization of Rab12 with the lysosomal marker LAMP1 but not with the Golgi marker GM130 (as quantified by Pearson’s correlation coefficient). This co-localization was retained upon nocodazole treatment (see new data included in figure 3D and Figure 3-figure supplement 1). These data support our hypothesis that lysosomal damage increases the localization of Rab12 to lysosomes and not Golgi-derived vesicles.

2) LLOMe treatment also significantly increased the colocalization of LRRK2 with LAMP1 but not with the Golgi marker GM130 (quantified by Pearson’s correlation coefficient). As was observed with Rab12, this co-localization was retained upon nocodazole treatment (see new data in Figure 3G and Figure 3-figure supplement 2). These data add confidence to our conclusions that lysosomal damage increases the localization of LRRK2 to lysosomes.

3) To add confidence that Rab12 and LRRK2 colocalize following LLOMe treatment, we quantified their colocalization using Pearson’s correlation coefficient. We observed colocalization between Rab12 and LRRK2 following lysosomal damage and saw that this co-localization was preserved upon nocodazole treatment (new figure 3F). These data further support our conclusion that Rab12 and LRRK2 colocalize with one another following LLOMe treatment.

Overall, these data add confidence that a portion of LRRK2 and Rab12 localize to lysosomes a baseline, LLOMe treatment induces increased localization of both LRRK2 and Rab12 to lysosomes but not to the Golgi, and LRRK2 and Rab12 colocalize following lysosomal damage. We thank the reviewer for their suggestion that has further strengthened our conclusions.

Reviewer #2 (Recommendations for the authors):

The authors have responded to all of the concerns raised. It is nice to see that LRRK2 is not required for the localization of rab12 to the lysosome. What is very clear is that LLOMe recruits rab12 to the lysosome, induces phosphorylation of rab10 and rab12 is required for phosphorylation of rab10. However, a discrepancy remains between the recruitment of LRRK2 to the lysosome by LLOMe, which is not as apparent for wt LRRK2 in Fig. 4D as in 4A, and the phosphorylation of rab10 induced by LLOMe (4B,C). So it seems likely, as the authors have now included in the results, that mechanisms other than lysosomal recruitment of LRRK2 contribute to the phosphorylation of rab10. Importantly, they have also shown that LRRK2 is responsible for the induction by LLOMe (Fig. 2), so I think this is fine, but they should probably include this important consideration in the discussion as well as the results.

We are pleased that our previous submission addressed all of the concerns raised by this reviewer and thank them for their suggestions that have substantially improved our manuscript. We agree that additional mechanisms beyond lysosomal recruitment of LRRK2 may contribute to the phosphorylation of Rab10. In addition to the text that was added in the results section around this in our last submission, we have updated the discussion to also include this important consideration as suggested by the reviewer. Specifically, we have added the following text to the Discussion (lines 908-915):

“We cannot rule out that additional mechanisms beyond increased proximity between LRRK2 and its Rab substrates may contribute to Rab10 phosphorylation following lysosomal damage, as the magnitude of Rab10 phosphorylation induced by LLOMe treatment was greater than the extent of LRRK2 recruitment to damaged lysosomes. Additional studies are warranted to determine how lysosomal membrane rupture triggers Rab12 recruitment, to identify other regulatory processes that may contribute to Rab phosphorylation upon lysosomal damage, and to better define how broadly such mechanisms are employed to drive LRRK2 activation in PD.”

Reviewer #3 (Recommendations for the authors):

The revised manuscript provides strong evidence that Rab12 can regulate the ability of LRRK2 to phosphorylate Rab10 and that this occurs at least in part by regulating the abundance of LRRK2 at lysosomes. Although key questions about the mechanism remain unanswered, these are still important findings. New data was added to the manuscript that helped to address concerns that were raised during the previous review. Below I have provided some suggestions for clarification to the text that should be addressable without the need for new experiments. However, I also remain concerned about some important results and their interpretation (points 1-).

1. There is a discrepancy between the strong decrease in LAMP1 levels in the lysosome IP samples in Figure 3A and that is not seen in the LAMP1 immunofluorescence signal in 3C. This should be acknowledged and/or explained in the text.

The reviewer correctly notes that we did not observe a significant decrease in LAMP1 signal assessed via imaging following LLOMe treatment, in contrast to the decrease observed in isolated lysosomes. LLOMe treatment leads to permeabilization of the lysosomal membrane, and these data may suggest that we are immunopurifying fragments of lysosomal membrane from which LAMP1 has been dissociated or perhaps degraded. We observed strong recruitment of Gal3 to isolated lysosomes following lysosomal damage, supporting some membrane integrity and glycocalyx remain after LLOMe treatment. Our imaging-based analysis did not show obvious differences in LAMP1 signal with LLOMe treatment, likely because our fixation and imaging conditions would capture lysosomal membrane fragments and dissociated LAMP1.

To acknowledge this point, we have added the following text to the results section (lines 287-295):

“While LLOMe treatment reduced the levels of lysosomal-associated membrane protein 1 (LAMP1) in isolated lysosomes, the levels and localization of TMEM192-3xHA, the lysosomal membrane protein used to isolate lysosomes, were not significantly impacted by LLOMe treatment (Figure 3A and Figure 3- figure supplement 1). We did not observe a loss of LAMP1 signal by immunofluorescence analysis, suggesting that LAMP1 may dissociate or be degraded from ruptured lysosomal membranes upon immunopurification. These data suggest that while LLOMe treatment results in lysosomal membrane damage, sufficient lysosomal integrity remains to enable purification of this subcellular compartment using TMEM192.”

2. Lines 272-275 imply that previous studies (references 32 and 33) also saw reductions in LAMP1 levels on purified lysosomes following LLoMe treatment. However, I could not find evidence of this in the papers that were cited.

We appreciate that the inclusion of references 32 and 33 in our previous draft following our comment around potential explanations for the reduction in LAMP1 levels observed on isolated damaged lysosomes was not clearly elaborated. References 32 and 33 had been previously included to support our hypothesis that LAMP1 levels may be reduced due to enhanced lysophagy or redistribution to small vesicles upon damage. These papers showed that LLOMe treatment led to the redistribution of LAMP2 to the cytoplasm or increased the turnover of LAMP1, respectively. However, based on the great point raised by this reviewer that LAMP1 signal loss was not observed in our imaging-based studies, our speculation is that we are immunopurifying lysosomal membrane fragments from which LAMP1 has dissociated or been degraded. We have revised the text as described above in Point 1 to better reflect our thinking on this and removed reference to these papers entirely in the updated manuscrpt.

3. There is still a discrepancy between Figure 4A-C where LLoMe activates LRRK2 (as measured by phosphor-Rab10) even in the context of VPS35-D620N and LRRK2-R1441G and Figure 4D where LLoMe does not change LRRK2 lysosome abundance in the same cells. The authors touched on this in the response to reviewers but the answer was not definitive. The description and interpretation of these results in the manuscript text is confusing as it is unclear to what extent LRRK2 kinase activity is regulated in response to these stimuli versus LRRK2 localization and proximity to substrates. The data suggests that there might be independent changes to LRRK2 localization and activity. It is not necessary for the authors to solve these puzzles but they should be more clearly presented.

We sincerely appreciate the reviewer’s feedback that the description and interpretation of our results around the magnitude of increase in Rab10 phosphorylation being greater than the increase in LRRK2 localization to lysosomes observed following LLOMe treatment should be edited to more clearly represent our ideas on the balance between activity versus localization. To further clarify our results and interpretation of our data, we have modified our results section to the following (lines 849-857):

“The levels of LRRK2 on lysosomes were significantly increased in untreated LRRK2 R1441G KI cells and VPS35 D620N KI cells, suggesting that enhanced localization of LRRK2 to lysosomes and proximity to its Rab substrates may contribute to the elevated Rab10 phosphorylation observed on lysosomes at baseline in these cells (Figure 4D). Rab10 phosphorylation was increased on lysosomes in response to LLOMe treatment while the levels of LRRK2 were not significantly impacted on lysosomes isolated from LRRK2 R1441G and VPS35 D620N KI cells, suggesting additional mechanisms beyond LRRK2 localization may also contribute to LRRK2 activation in response to lysosomal damage in these cells.”

Further, we have added the following text to the Discussion (lines 908-915):

“We cannot rule out that additional mechanisms beyond increased proximity between LRRK2 and its Rab substrates may contribute to Rab10 phosphorylation following lysosomal damage, as the magnitude of Rab10 phosphorylation induced by LLOMe treatment was greater than the extent of LRRK2 recruitment to damaged lysosomes. Additional studies are warranted to determine how lysosomal membrane rupture triggers Rab12 recruitment, to identify other regulatory processes that may contribute to Rab phosphorylation upon lysosomal damage, and to better define how broadly such mechanisms are employed to drive LRRK2 activation in PD.”

4. Line 168: The statement that Rab12 is necessary and sufficient is too strong. Some commentary is required to at minimum acknowledge that this study only examined A549 cells and that the extent that the findings are generalizable to other cell types remains unknown.

Based on the reviewer’s suggestions, we have removed our statement regarding Rab12 being necessary and sufficient. Specifically, we have revised the text in the results section (line 165 on page 10) from “Rab12 is necessary and sufficient for LRRK2-dependent phosphorylation of Rab10” to “Rab12 deletion attenuates LRRK2-dependent phosphorylation of Rab10.” Further, we have added the following text to the Discussion (lines 915-918 on page 31):

“As our work focused on the role of Rab12 in A549 cells, it will also be important to understand whether Rab12 similarly regulates LRRK2 activation and localization to damaged lysosomes in other cell types.”

5. Figure 3A and D and Figure 4A-D should also show the total cell lysates rather than just the IP results.

We thank the reviewer for their suggestion to include the results from total cell lysates in addition to our IP results. We have included side by side blots showing the western blot data from the immunoprecipitated samples as well as the PNS (post-nuclear supernatant, the input fraction used for the Lyso-IPs). These have been added to Figure 3- figure supplement 1B and F and Figure 4-figure supplement 1A-D.

6. Figure 4E and Line 505 over-reach in stating that Rab12 mediates LRRK2 recruitment to lysosomes. Proving this would require evidence that a direct interaction between LRRK2 and Rab12 is necessary for LRRK2 recruitment and activation.

We appreciate the reviewer’s point regarding softening our language around Rab12 mediating LRRK2 recruitment to lysosomes without direct evidence that an interaction between these proteins is required for LRRK2 recruitment to damaged lysosomes. We have revised Figure 4E from “Rab12 mediates LRRK2 recruitment and Rab phosphorylation on lysosomes” to “Rab12 regulates LRRK2 recruitment and Rab phosphorylation on lysosomes.” Further, we have revised the sentence in the discussion to remove “mediates” and instead use the word “regulates”:

“Our findings provide key insight into the mechanism by which LRRK2 activity is increased in response to lysosomal damage by demonstrating that Rab12 regulates LRRK2 localization to ruptured lysosomes.”

https://doi.org/10.7554/eLife.87255.sa2

Article and author information

Author details

  1. Xiang Wang

    Denali Therapeutics, South San Francisco, United States
    Contribution
    Conceptualization, Formal analysis, Validation, Investigation, Visualization, Writing – original draft, Writing – review and editing
    Contributed equally with
    Vitaliy V Bondar
    Competing interests
    is an employee of Denali Therapeutics
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0001-5134-1292

  2. Vitaliy V Bondar

    Denali Therapeutics, South San Francisco, United States
    Present address
    REGENXBIO Inc, Rockville, United States
    Contribution
    Conceptualization, Formal analysis, Investigation, Visualization, Methodology, Writing – review and editing
    Contributed equally with
    Xiang Wang
    Competing interests
    was an employee of Denali Therapeutics when these studies were conducted and is currently an employee of REGENEXBIO Inc

  3. Oliver B Davis

    Denali Therapeutics, South San Francisco, United States
    Contribution
    Formal analysis, Validation, Investigation, Visualization, Writing – original draft, Writing – review and editing
    Competing interests
    is an employee of Denali Therapeutics
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-3622-8651

  4. Michael T Maloney

    Denali Therapeutics, South San Francisco, United States
    Contribution
    Conceptualization, Formal analysis, Validation, Investigation, Visualization, Methodology, Writing – original draft, Writing – review and editing
    Competing interests
    is an employee of Denali Therapeutics

  5. Maayan Agam

    Denali Therapeutics, South San Francisco, United States
    Contribution
    Validation, Investigation, Visualization
    Competing interests
    is an employee of Denali Therapeutics

  6. Marcus Y Chin

    Denali Therapeutics, South San Francisco, United States
    Contribution
    Formal analysis, Investigation, Visualization, Methodology, Writing – review and editing
    Competing interests
    is an employee of Denali Therapeutics

  7. Audrey Cheuk-Nga Ho

    Denali Therapeutics, South San Francisco, United States
    Present address
    Cellares, South San Francisco, United States
    Contribution
    Formal analysis, Investigation, Visualization
    Competing interests
    was an employee of Denali Therapeutics when these studies were conducted and is currently an employee of Cellares

  8. Rajarshi Ghosh

    Denali Therapeutics, South San Francisco, United States
    Contribution
    Formal analysis, Investigation, Visualization, Methodology
    Competing interests
    is an employee of Denali Therapeutics

  9. Dara E Leto

    Denali Therapeutics, South San Francisco, United States
    Contribution
    Conceptualization, Methodology, Writing – review and editing
    Competing interests
    is an employee of Denali Therapeutics

  10. David Joy

    Denali Therapeutics, South San Francisco, United States
    Contribution
    Conceptualization, Formal analysis, Investigation, Visualization, Methodology, Writing – original draft
    Competing interests
    is an employee of Denali Therapeutics
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0001-9941-9538

  11. Meredith EK Calvert

    Denali Therapeutics, South San Francisco, United States
    Contribution
    Supervision, Writing – review and editing
    Competing interests
    is an employee of Denali Therapeutics

  12. Joseph W Lewcock

    Denali Therapeutics, South San Francisco, United States
    Contribution
    Conceptualization, Supervision, Writing – review and editing
    Competing interests
    is an employee of Denali Therapeutics
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0003-3012-7881

  13. Gilbert Di Paolo

    Denali Therapeutics, South San Francisco, United States
    Contribution
    Conceptualization, Writing – review and editing
    Competing interests
    is an employee of Denali Therapeutics

  14. Robert G Thorne

    1. Denali Therapeutics, South San Francisco, United States
    2. Department of Pharmaceutics, University of Minnesota, Minneapolis, United States
    Contribution
    Conceptualization, Supervision, Writing – review and editing
    Competing interests
    is an employee of Denali Therapeutics

  15. Zachary K Sweeney

    Denali Therapeutics, South San Francisco, United States
    Present address
    Interline Therapeutics Inc, Brisbane, United States
    Contribution
    Conceptualization, Supervision, Writing – review and editing
    Competing interests
    was an employee of Denali Therapeutics when these studies were conducted and is currently an employee of Interline Therapeutics Inc

  16. Anastasia G Henry

    Denali Therapeutics, South San Francisco, United States
    Contribution
    Conceptualization, Formal analysis, Supervision, Visualization, Writing – original draft, Project administration, Writing – review and editing
    For correspondence
    henry@dnli.com
    Competing interests
    is an employee of Denali Therapeutics
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-8124-5477

Funding

No external funding was received for this work.

Acknowledgements

We thank members of the Denali post doc program and lysosomal function pathway team for useful discussions and feedback. We also thank Dario Alessi for his generosity in sharing his RAB29 KO A549 cell model.

Senior Editor

  1. Vivek Malhotra, Barcelona Institute for Science and Technology, Spain

Reviewing Editor

  1. Shaeri Mukherjee, University of California, San Francisco, United States

Version history

  1. Preprint posted: February 22, 2023 (view preprint)
  2. Received: February 24, 2023
  3. Accepted: October 23, 2023
  4. Accepted Manuscript published: October 24, 2023 (version 1)
  5. Version of Record published: December 8, 2023 (version 2)

Copyright

© 2023, Wang, Bondar et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.

Metrics

  • 594
    Page views
  • 216
    Downloads
  • 1
    Citations

Article citation count generated by polling the highest count across the following sources: Crossref, PubMed Central, Scopus.

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Xiang Wang
  2. Vitaliy V Bondar
  3. Oliver B Davis
  4. Michael T Maloney
  5. Maayan Agam
  6. Marcus Y Chin
  7. Audrey Cheuk-Nga Ho
  8. Rajarshi Ghosh
  9. Dara E Leto
  10. David Joy
  11. Meredith EK Calvert
  12. Joseph W Lewcock
  13. Gilbert Di Paolo
  14. Robert G Thorne
  15. Zachary K Sweeney
  16. Anastasia G Henry
(2023)
Rab12 is a regulator of LRRK2 and its activation by damaged lysosomes
eLife 12:e87255.
https://doi.org/10.7554/eLife.87255

Categories and tags

Research organism

Further reading

    1. Cell Biology

    Genome-wide screen reveals Rab12 GTPase as a critical activator of Parkinson’s disease-linked LRRK2 kinase

    Herschel S Dhekne, Francesca Tonelli ... Suzanne R Pfeffer
    Research Advance Updated

    Activating mutations in the leucine-rich repeat kinase 2 (LRRK2) cause Parkinson’s disease. LRRK2 phosphorylates a subset of Rab GTPases, particularly Rab10 and Rab8A, and we showed previously that these phosphoRabs play an important role in LRRK2 membrane recruitment and activation (Vides et al., 2022). To learn more about LRRK2 pathway regulation, we carried out an unbiased, CRISPR-based genome-wide screen to identify modifiers of cellular phosphoRab10 levels. A flow cytometry assay was developed to detect changes in phosphoRab10 levels in pools of mouse NIH-3T3 cells harboring unique CRISPR guide sequences. Multiple negative and positive regulators were identified; surprisingly, knockout of the Rab12 gene was especially effective in decreasing phosphoRab10 levels in multiple cell types and knockout mouse tissues. Rab-driven increases in phosphoRab10 were specific for Rab12, LRRK2-dependent and PPM1H phosphatase-reversible, and did not require Rab12 phosphorylation; they were seen with wild type and pathogenic G2019S and R1441C LRRK2. As expected for a protein that regulates LRRK2 activity, Rab12 also influenced primary cilia formation. AlphaFold modeling revealed a novel Rab12 binding site in the LRRK2 Armadillo domain, and we show that residues predicted to be essential for Rab12 interaction at this site influence phosphoRab10 and phosphoRab12 levels in a manner distinct from Rab29 activation of LRRK2. Our data show that Rab12 binding to a new site in the LRRK2 Armadillo domain activates LRRK2 kinase for Rab phosphorylation and could serve as a new therapeutic target for a novel class of LRRK2 inhibitors that do not target the kinase domain.

    1. Cell Biology

    Differential regulation of hair cell actin cytoskeleton mediated by SRF and MRTFB

    Ling-Yun Zhou, Chen-Xi Jin ... Hao Wu
    Research Article Updated

    The MRTF–SRF pathway has been extensively studied for its crucial role in driving the expression of a large number of genes involved in actin cytoskeleton of various cell types. However, the specific contribution of MRTF–SRF in hair cells remains unknown. In this study, we showed that hair cell-specific deletion of Srf or Mrtfb, but not Mrtfa, leads to similar defects in the development of stereocilia dimensions and the maintenance of cuticular plate integrity. We used fluorescence-activated cell sorting-based hair cell RNA-Seq analysis to investigate the mechanistic underpinnings of the changes observed in Srf and Mrtfb mutants, respectively. Interestingly, the transcriptome analysis revealed distinct profiles of genes regulated by Srf and Mrtfb, suggesting different transcriptional regulation mechanisms of actin cytoskeleton activities mediated by Srf and Mrtfb. Exogenous delivery of calponin 2 using Adeno-associated virus transduction in Srf mutants partially rescued the impairments of stereocilia dimensions and the F-actin intensity of cuticular plate, suggesting the involvement of Cnn2, as an Srf downstream target, in regulating the hair bundle morphology and cuticular plate actin cytoskeleton organization. Our study uncovers, for the first time, the unexpected differential transcriptional regulation of actin cytoskeleton mediated by Srf and Mrtfb in hair cells, and also demonstrates the critical role of SRF–CNN2 in modulating actin dynamics of the stereocilia and cuticular plate, providing new insights into the molecular mechanism underlying hair cell development and maintenance.

    1. Cell Biology

    Hsf1 and the molecular chaperone Hsp90 support a ‘rewiring stress response’ leading to an adaptive cell size increase in chronic stress

    Samarpan Maiti, Kaushik Bhattacharya ... Didier Picard
    Research Article

    Cells are exposed to a wide variety of internal and external stresses. Although many studies have focused on cellular responses to acute and severe stresses, little is known about how cellular systems adapt to sublethal chronic stresses. Using mammalian cells in culture, we discovered that they adapt to chronic mild stresses of up to two weeks, notably proteotoxic stresses such as heat, by increasing their size and translation, thereby scaling the amount of total protein. These adaptations render them more resilient to persistent and subsequent stresses. We demonstrate that Hsf1, well known for its role in acute stress responses, is required for the cell size increase, and that the molecular chaperone Hsp90 is essential for coupling the cell size increase to augmented translation. We term this translational reprogramming the ‘rewiring stress response’, and propose that this protective process of chronic stress adaptation contributes to the increase in size as cells get older, and that its failure promotes aging.